[Bioperl-l] Proposed improvement to to Bio::Tools::Run::Primer3Redux

[Chris Fields]

John,

This patch is made off an older version of Bio-Tools-Primer3Redux, which is now hosted in a separate repo on GitHub:

https://github.com/cjfields/Bio-Tools-Primer3Redux

I get one patch failure against the latest code which is easily added (the SEQUENCE_PRIMER_PAIR_OK_REGION_LIST parameter), but tests now fail (see below).  Can you resubmit this against the latest code?

chris


$ ./Build test --test-files t/Run/Primer3Redux.t --verbose
t/Run/Primer3Redux.t .. Subroutine p3_settings_file redefined at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 620.

ok 1 - use Bio::Tools::Run::Primer3Redux;
ok 2
ok 3 - program_name
SEQUENCE_ID=Test1

SEQUENCE_TEMPLATE=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGGTCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTACACAACATCCATGAAACGCATTAGCACCACC

PRIMER_EXPLAIN_FLAG=1

PRIMER_PRODUCT_SIZE_RANGE=100-250

PRIMER_SALT_CORRECTIONS=1

PRIMER_TASK=pick_pcr_primers

PRIMER_TM_FORMULA=1

=
Unknown open() mode '/Users/cjfields/bin/primer3_core  </var/folders/Nj/Njn+dA2IGey0Gxn+92zej++++TI/-Tmp-/NAGb_w_8Rs' at /Users/cjfields/bioperl/Bio-Tools-Primer3Redux/blib/lib/Bio/Tools/Run/Primer3Redux.pm line 705.
# Tests were run but no plan was declared and done_testing() was not seen.
Dubious, test returned 255 (wstat 65280, 0xff00)
All 3 subtests passed 

Test Summary Report
-------------------
t/Run/Primer3Redux.t (Wstat: 65280 Tests: 3 Failed: 0)
  Non-zero exit status: 255
  Parse errors: No plan found in TAP output
Files=1, Tests=3,  1 wallclock secs ( 0.02 usr  0.01 sys +  0.20 cusr  0.04 csys =  0.27 CPU)
Result: FAIL
Failed 1/1 test programs. 0/3 subtests failed.

On Jan 24, 2011, at 11:44 AM, Ma, Man Chun John wrote:

> Hi,
> 
> Attached are my proposed diff for some changes for Bio::Tools::Run::Primer3Redux to more fully implement the new features of Primer3 version 2.x.x:
> 
> 1. Adding support for the commond-line argument p3_settings_file that has been available for all 2.x.x versions, and
> 2. Adding support for the "Sequence" tag SEQUENCE_PRIMER_PAIR_OK_REGION_LIST, a new function in version 2.2.3
> 
> Although I have used this module quite heavily in my projects and it appeared to run well, I'm not sure if there are bugs--not to say I have yet understand how to write /t scripts, so I wonder if someone would like to test this up.
> 
> Cheers,
> 
> John MC Ma
> Graduate Assistant
> Kwitek Lab
> Department of Internal Medicine
> 3125E MERF
> 375 Newton Road
> Iowa City IA 52242<Primer3Redux.patch>_______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l