[Bioperl-l] Bioperl and Mysql

[Hilmar Lapp]

You probably got a lot of errors when you uploaded the file didn't you?  
Always post error messages.

The problem with fasta files is that the Bioperl SeqIO parser (for  
legitimate reasons) doesn't parse out an accession number, which,  
however, is part of the unique key constraint. So you probably you do  
have one sequence in the database; the only way you can get an empty  
database after running a non-empty file is by failure to connect,  
failure to load (find) the bioperl/bioperl-db modules, or by providing  
--testonly to the load_seqdatabase.pl script. Only the latter will be  
silent.

See http://bioperl.org/pipermail/bioperl-l/2005-August/019579.html for  
what you need to do in order to load fasta-formatted files into biosql.

If none of this can be the problem, run the bioperl-db tests and report  
the outcome.

	-hilmar

On Dec 6, 2005, at 10:28 PM, chen li wrote:

> Hi Hilmar,
>
>  I download a small fasta-format sequence file from
> NCBI and populate the database. But I can't retrieve
> them within mysql as a root user. The biosql database
> is empty. What is going on?
>
> Thanks,
>
> Li
>
>
>
> [alex at cpe-65-189-147-4 biosql]$ perl
> load_seqdatabase.pl --host localhost --dbname biosql
> /home/alex/DB/RNA.fasta
> Loading /home/alex/DB/RNA.fasta ...
>
> A small part of my file:
>> gi|21237774|ref|NM_139124.1| Homo sapiens
> mitogen-activated protein kinase 8 interacting protein
> 2 (MAPK8IP2), transcript variant 3, mRNA
> CGCGGGGCGGACGCCGCAGGGCGTGTCACGAGGTGAGCGGGGCGGGCCGAGCGCCGGCGCGGGGCGCGGCG 
> AGGCTCCCG
> ...........................
>
>
>
>
>
>
> 		
> __________________________________________
> Yahoo! DSL – Something to write home about.
> Just $16.99/mo. or less.
> dsl.yahoo.com
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp at gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------