[Bioperl-l] Bioperl and Mysql

[chen li]

Hi Hilmar,

 I download a small fasta-format sequence file from
NCBI and populate the database. But I can't retrieve
them within mysql as a root user. The biosql database
is empty. What is going on?

Thanks,

Li



[alex at cpe-65-189-147-4 biosql]$ perl
load_seqdatabase.pl --host localhost --dbname biosql
/home/alex/DB/RNA.fasta
Loading /home/alex/DB/RNA.fasta ...

A small part of my file:
>gi|21237774|ref|NM_139124.1| Homo sapiens
mitogen-activated protein kinase 8 interacting protein
2 (MAPK8IP2), transcript variant 3, mRNA
CGCGGGGCGGACGCCGCAGGGCGTGTCACGAGGTGAGCGGGGCGGGCCGAGCGCCGGCGCGGGGCGCGGCGAGGCTCCCG
...........................






		
__________________________________________ 
Yahoo! DSL – Something to write home about. 
Just $16.99/mo. or less. 
dsl.yahoo.com