[Bioperl-l] setting remote blast

[Fields, Christopher J]

This is possible but you will have to know what the short name is for the BLAST database you are interested in.  I know this is accessible via eutils but haven’t actually looked into how to query it.  Doing this via the Entrez web interface doesn’t seem possible strangely, as it would be the most obvious (though I suppose it would only be information applicable mainly to us code junkies :)

chris

On Apr 25, 2014, at 4:37 AM, Pau Marc Muñoz Torres <paumarc at gmail.com> wrote:

> Hi every body
> 
> I'm trying  to performe a remote blast, looking at the web i could set up
> a basic script that runs well ( i paste it under those lines), the problem
> here is that I can replicate the results obtained at the webpage. I would
> lke to change the database to *"Genome (all assemblies top-level,Annotation
> release 106)"*  any body can tell me how to do it? when i try the option
> genome i have no results
> 
> pau
> 
> use  Bio::Seq;
> use Bio::Perl;
> use Bio::Tools::Run::RemoteBlast;
> use strict;
> my $prog = 'blastn';
> my $db   = 'nr'; # nr    Non-redundant GenBank CDS translations + PDB +
> SwissProt + PIR + PRF, excluding those in env_nr.
> my $e_val= '1e-1';
> my @params = ( '-prog' => $prog,'-data' => $db,'-expect' => $e_val,
> '-readmethod' => 'xml' );
> my $factory = Bio::Tools::Run::RemoteBlast->new(@params);
> $Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'} = 'Homo sapiens
> [ORGN]';
> 
> #change a retrieval parameter
> $Bio::Tools::Run::RemoteBlast::RETRIEVALHEADER{'DESCRIPTIONS'} = 1000;
> 
> 
> #qq$Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'} = 100;
> my $str =  Bio::Seq->new(-seq =>
> "TCCACAACCTCTACAAGATGATGGCCAATGGGATCCTCAAGG",-display_id => "nls" -desc =>
> "nls sequence",-alphabet => "dna" );
> my $blast_report = blast_sequence($str);
> 
> write_blast(">blast_g.out",$blast_report);
> 
> 
> Pau Marc Muñoz Torres
> skype: pau_marc
> http://www.linkedin.com/in/paumarc
> http://www.researchgate.net/profile/Pau_Marc_Torres3/info/
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l