[Bioperl-l] setting remote blast

[Pau Marc Muñoz Torres]

Hi every body

 I'm trying  to performe a remote blast, looking at the web i could set up
a basic script that runs well ( i paste it under those lines), the problem
here is that I can replicate the results obtained at the webpage. I would
lke to change the database to *"Genome (all assemblies top-level,Annotation
release 106)"*  any body can tell me how to do it? when i try the option
genome i have no results

pau

use  Bio::Seq;
use Bio::Perl;
use Bio::Tools::Run::RemoteBlast;
use strict;
my $prog = 'blastn';
my $db   = 'nr'; # nr    Non-redundant GenBank CDS translations + PDB +
SwissProt + PIR + PRF, excluding those in env_nr.
my $e_val= '1e-1';
my @params = ( '-prog' => $prog,'-data' => $db,'-expect' => $e_val,
'-readmethod' => 'xml' );
my $factory = Bio::Tools::Run::RemoteBlast->new(@params);
$Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'} = 'Homo sapiens
[ORGN]';

#change a retrieval parameter
$Bio::Tools::Run::RemoteBlast::RETRIEVALHEADER{'DESCRIPTIONS'} = 1000;


#qq$Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'} = 100;
my $str =  Bio::Seq->new(-seq =>
"TCCACAACCTCTACAAGATGATGGCCAATGGGATCCTCAAGG",-display_id => "nls" -desc =>
"nls sequence",-alphabet => "dna" );
my $blast_report = blast_sequence($str);

write_blast(">blast_g.out",$blast_report);


Pau Marc Muñoz Torres
skype: pau_marc
http://www.linkedin.com/in/paumarc
http://www.researchgate.net/profile/Pau_Marc_Torres3/info/