[Bioperl-l] setting remote blast

[Smithies, Russell]

You probably need to query blastdbinfo to get the shortname eg.
http://eutils.ncbi.nlm.nih.gov/entrez/eutils/esearch.fcgi?db=blastdbinfo&term=all+assemblies+top-level+release+106

Then get the database info:
http://eutils.ncbi.nlm.nih.gov/entrez/eutils/esummary.fcgi?db=blastdbinfo&id=9985374

Then - I'm not sure, maybe use the dbid or path as the name in your blast query?

--Russell

-----Original Message-----
From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Fields, Christopher J
Sent: Saturday, 26 April 2014 5:25 a.m.
To: Pau Marc Muñoz Torres
Cc: BioPerl List
Subject: Re: [Bioperl-l] setting remote blast

This is possible but you will have to know what the short name is for the BLAST database you are interested in.  I know this is accessible via eutils but haven't actually looked into how to query it.  Doing this via the Entrez web interface doesn't seem possible strangely, as it would be the most obvious (though I suppose it would only be information applicable mainly to us code junkies :)

chris

On Apr 25, 2014, at 4:37 AM, Pau Marc Muñoz Torres <paumarc at gmail.com> wrote:

> Hi every body
> 
> I'm trying  to performe a remote blast, looking at the web i could set 
> up a basic script that runs well ( i paste it under those lines), the 
> problem here is that I can replicate the results obtained at the 
> webpage. I would lke to change the database to *"Genome (all 
> assemblies top-level,Annotation release 106)"*  any body can tell me 
> how to do it? when i try the option genome i have no results
> 
> pau
> 
> use  Bio::Seq;
> use Bio::Perl;
> use Bio::Tools::Run::RemoteBlast;
> use strict;
> my $prog = 'blastn';
> my $db   = 'nr'; # nr    Non-redundant GenBank CDS translations + PDB +
> SwissProt + PIR + PRF, excluding those in env_nr.
> my $e_val= '1e-1';
> my @params = ( '-prog' => $prog,'-data' => $db,'-expect' => $e_val, 
> '-readmethod' => 'xml' ); my $factory = 
> Bio::Tools::Run::RemoteBlast->new(@params);
> $Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'} = 'Homo sapiens 
> [ORGN]';
> 
> #change a retrieval parameter
> $Bio::Tools::Run::RemoteBlast::RETRIEVALHEADER{'DESCRIPTIONS'} = 1000;
> 
> 
> #qq$Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'} = 100; my 
> $str =  Bio::Seq->new(-seq => 
> "TCCACAACCTCTACAAGATGATGGCCAATGGGATCCTCAAGG",-display_id => "nls" 
> -desc => "nls sequence",-alphabet => "dna" ); my $blast_report = 
> blast_sequence($str);
> 
> write_blast(">blast_g.out",$blast_report);
> 
> 
> Pau Marc Muñoz Torres
> skype: pau_marc
> http://www.linkedin.com/in/paumarc
> http://www.researchgate.net/profile/Pau_Marc_Torres3/info/
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


_______________________________________________
Bioperl-l mailing list
Bioperl-l at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/bioperl-l