[Bioperl-l] Bioperl

[debutant.bioperl]

Good morning,
I download a file containing the upstream sequences of genes from a
database.
these sequences are in FASTA format.
explanatory example of sequence :
> XX1G56520 | :2695538-2696537 FORWARD CHR1 LENGTH =
> 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG> YY1G56520 |
> :2695538-2696539 FORWARD CHR1 LENGTH =
> 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG ....
I want to write code in Bioperl that :
*reads the file containing the sequences (you can open it with notepad, Word
...)
*looking for a pattern  (eg. GAGAGAGATCGA)
*gives what is this gene sequence (eg the pattern italic we note gene code
"XX1G56520. ID, which is just past the sign"> "before the pattern)
*determines the position of this motif from the start codon, otherwise count
the letter starting with the first letter pattern until the last letter
before the sign ">" Next.
*give the results as a table containing the code for each gene and the
position corresponding pattern (number of letters to find plus a negative
sign  "- ")
if you want more explanation I am always at your disposal.
Please help me is urgent %-|
cordially
-- 
View this message in context: http://old.nabble.com/Bioperl-tp31542007p31542007.html
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.