[Bioperl-l] Bioperl

[Dave Messina]

Um, this sounds an awful lot like homework to me.


Dave


On Wed, May 4, 2011 at 15:51, debutant.bioperl <joyeux2000 at hotmail.fr>wrote:

>
> Good morning,
> I download a file containing the upstream sequences of genes from a
> database.
> these sequences are in FASTA format.
> explanatory example of sequence :
> > XX1G56520 | :2695538-2696537 FORWARD CHR1 LENGTH =
> > 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG> YY1G56520 |
> > :2695538-2696539 FORWARD CHR1 LENGTH =
> > 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG ....
> I want to write code in Bioperl that :
> *reads the file containing the sequences (you can open it with notepad,
> Word
> ...)
> *looking for a pattern  (eg. GAGAGAGATCGA)
> *gives what is this gene sequence (eg the pattern italic we note gene code
> "XX1G56520. ID, which is just past the sign"> "before the pattern)
> *determines the position of this motif from the start codon, otherwise
> count
> the letter starting with the first letter pattern until the last letter
> before the sign ">" Next.
> *give the results as a table containing the code for each gene and the
> position corresponding pattern (number of letters to find plus a negative
> sign  "- ")
> if you want more explanation I am always at your disposal.
> Please help me is urgent %-|
> cordially
> --
> View this message in context:
> http://old.nabble.com/Bioperl-tp31542007p31542007.html
> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>