[Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to be parsed

[Dave Messina]

Hi Mick,

Please email the list — that way others who can help will know what's going on.

I looked at this for a few minutes and it seems that the issue is that the FASTA output doen't have any end-of-report indicator in a multiple query output file. The report just ends and then the next report begins.


e.g.

[ beginning of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448

[ middle of report 1 omitted ]

                                 10        20   
2-210532                 UAGCUUAUCAGACUGAUGUUGAC
                         : :.:::::::. :::::     
cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG     
                            10        20        

[ implicit end of report 1 ]

 /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i test.fa ../other_mirs.fa -O test.fasta35
FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26, 2009
Please cite:
 W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
[ rest of report 2 omitted [


I don't know whether or how this has changed from earlier versions of FASTA — presumably we were detecting end-of-report just fine for earlier versions — but in any case we need to fix it for version 35.

I will try to work on it some more but I'm pretty short of time right now — perhaps other devs could take a look?



Dave



On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:

> Hi Dave
> 
> I'm still having an associated bug from this fix, created last week:
> 
> http://bugzilla.open-bio.org/show_bug.cgi?id=3058
> 
> At present, this is a real show stopper for my analysis.  
> 
> Mick
> 
> -----Original Message-----
> From: Dave Messina [mailto:David.Messina at sbc.su.se] 
> Sent: 23 November 2009 17:46
> To: michael watson (IAH-C)
> Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be parsed
> 
> Hi Mick,
> 
> Sure thing -- the current build from subversion is packaged up every  
> night and available here:
> http://www.bioperl.org/DIST/nightly_builds/
> 
> Just grab bioperl-live.tar.gz from there and you'll get the changes.
> 
> 
> Dave
> 
> 
> 
> 
> On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
> 
>> Hi Dave
>> 
>> Thanks for the hard work.
>> 
>> Trying to get the latest updates so I can use this... don't have svn  
>> on my server, tried to install it and I don't have python either,  
>> which is needed to install it.
>> 
>> I face about 3 weeks whilst my IT department sort this out, unless I  
>> can access the changes any other way?
>> 
>> Thanks
>> Mick
>> 
>> -----Original Message-----
>> From: bugzilla-daemon at portal.open-bio.org [mailto:bugzilla- 
>> daemon at portal.open-bio.org]
>> Sent: 20 November 2009 15:12
>> To: michael watson (IAH-C)
>> Subject: [Bug 2937] Strand in fasta35 output does not seem to be  
>> parsed
>> 
>> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
>> 
>> 
>> online at davemessina.com changed:
>> 
>>          What    |Removed                     |Added
>> ----------------------------------------------------------------------------
>>            Status|NEW                         |RESOLVED
>>        Resolution|                            |FIXED
>> 
>> 
>> 
>> 
>> ------- Comment #7 from online at davemessina.com  2009-11-20 10:12 EST  
>> -------
>> Fixed in r16394.
>> 
>> Michael, thanks for the report. Your test cases pass, but please  
>> reopen the bug
>> if needed.
>> 
>> 
>> -- 
>> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi? 
>> tab=email
>> ------- You are receiving this mail because: -------
>> You reported the bug, or are watching the reporter.
>