[Bioperl-l] [Bug 2937] Strand in fasta35 output does not seem to be parsed

[Aaron Mackey]

This doesn't looks like a multi-query report; rather this looks like
multiple separate executions, each with one query, that has been
concatenated together.  I don't think any of our report parsers will work in
this scenario.

-Aaron


On Mon, Apr 19, 2010 at 7:35 AM, Dave Messina <David.Messina at sbc.su.se>wrote:

> Hi Mick,
>
> Please email the list — that way others who can help will know what's going
> on.
>
> I looked at this for a few minutes and it seems that the issue is that the
> FASTA output doen't have any end-of-report indicator in a multiple query
> output file. The report just ends and then the next report begins.
>
>
> e.g.
>
> [ beginning of report 1 ]
>
>  /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i
> test.fa ../other_mirs.fa -O test.fasta35
> FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26,
> 2009
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
>
> [ middle of report 1 omitted ]
>
>                                 10        20
> 2-210532                 UAGCUUAUCAGACUGAUGUUGAC
>                         : :.:::::::. :::::
> cel-miR-59          UCGAAUCGUUUAUCAGGAUGAUG
>                            10        20
>
> [ implicit end of report 1 ]
>
>  /usr/local/fasta3/bin/fasta35 -n -U -Q -H -A -E 2.0 -C 19 -m 0 -m 9i
> test.fa ../other_mirs.fa -O test.fasta35
> FASTA searches a protein or DNA sequence data bank version 35.04 Mar. 26,
> 2009
> Please cite:
>  W.R. Pearson & D.J. Lipman PNAS (1988) 85:2444-2448
> [ rest of report 2 omitted [
>
>
> I don't know whether or how this has changed from earlier versions of FASTA
> — presumably we were detecting end-of-report just fine for earlier versions
> — but in any case we need to fix it for version 35.
>
> I will try to work on it some more but I'm pretty short of time right now —
> perhaps other devs could take a look?
>
>
>
> Dave
>
>
>
> On Apr 19, 2010, at 11:31, michael watson (IAH-C) wrote:
>
> > Hi Dave
> >
> > I'm still having an associated bug from this fix, created last week:
> >
> > http://bugzilla.open-bio.org/show_bug.cgi?id=3058
> >
> > At present, this is a real show stopper for my analysis.
> >
> > Mick
> >
> > -----Original Message-----
> > From: Dave Messina [mailto:David.Messina at sbc.su.se]
> > Sent: 23 November 2009 17:46
> > To: michael watson (IAH-C)
> > Subject: Re: [Bug 2937] Strand in fasta35 output does not seem to be
> parsed
> >
> > Hi Mick,
> >
> > Sure thing -- the current build from subversion is packaged up every
> > night and available here:
> > http://www.bioperl.org/DIST/nightly_builds/
> >
> > Just grab bioperl-live.tar.gz from there and you'll get the changes.
> >
> >
> > Dave
> >
> >
> >
> >
> > On Nov 23, 2009, at 6:34 PM, michael watson (IAH-C) wrote:
> >
> >> Hi Dave
> >>
> >> Thanks for the hard work.
> >>
> >> Trying to get the latest updates so I can use this... don't have svn
> >> on my server, tried to install it and I don't have python either,
> >> which is needed to install it.
> >>
> >> I face about 3 weeks whilst my IT department sort this out, unless I
> >> can access the changes any other way?
> >>
> >> Thanks
> >> Mick
> >>
> >> -----Original Message-----
> >> From: bugzilla-daemon at portal.open-bio.org [mailto:bugzilla-
> >> daemon at portal.open-bio.org]
> >> Sent: 20 November 2009 15:12
> >> To: michael watson (IAH-C)
> >> Subject: [Bug 2937] Strand in fasta35 output does not seem to be
> >> parsed
> >>
> >> http://bugzilla.open-bio.org/show_bug.cgi?id=2937
> >>
> >>
> >> online at davemessina.com changed:
> >>
> >>          What    |Removed                     |Added
> >>
> ----------------------------------------------------------------------------
> >>            Status|NEW                         |RESOLVED
> >>        Resolution|                            |FIXED
> >>
> >>
> >>
> >>
> >> ------- Comment #7 from online at davemessina.com  2009-11-20 10:12 EST
> >> -------
> >> Fixed in r16394.
> >>
> >> Michael, thanks for the report. Your test cases pass, but please
> >> reopen the bug
> >> if needed.
> >>
> >>
> >> --
> >> Configure bugmail: http://bugzilla.open-bio.org/userprefs.cgi?
> >> tab=email
> >> ------- You are receiving this mail because: -------
> >> You reported the bug, or are watching the reporter.
> >
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>