[Bioperl-l] help with HOWTO script example

[matt geisler]

Hello, I am learning perl and bioperl (I am a mol biologist turning bioinformatics). I tried the example script in the beginners HOWTO tutorial and encountered errors.
   
  System Windows XP with Activeperl 5.8.7
  Writing the following script in notepad
   
  #!C:\perl\bin\perl.exe -w
use Bio::Seq;
$seq_obj = Bio::Seq->new(-seq =>"aaaatttggggggggcccccgtt" -alphabet => 'dna');
print $seq_obj->desc();
   
  error: arguement isn't numeric in subtraction line 3
   
  If I remove the -alphabet =>'dna' it works.
   
  I assume that it thinks I am trying to do a subtraction with the '-' symbol.
   
  The example text in beginners HOWTO insists that multiple properties of the object ($seq_obj) are assigned with dashes. 
   
  Is this true?
   
  If so, why is it thinking I am trying to subtract?

		
---------------------------------
Find your next car at Yahoo! Canada Autos