[Bioperl-l] TCoffee message

[vesi_radeva at mail.bg]

Hello Dear Colleagues,
I'm a new user of BioPerl!
I've wrote a simple script for TCoffee program, but when I start the script
there is a error mesage like this:
------
Can't call method "isa" on unblessed reference at D:/Perl/site/lib/Bio/Root/IO.p
m line 487, <GEN0> chunk 1.
------
My script is simple and I can't find where is my error!?:


use Bio::Seq;
use Bio::SeqIO;
use Bio::Tools::Run::Alignment::TCoffee;
$ENV{TCOFFEEDIR} = '/perl/tcoffee';

#The gene obj
  $geneDNA = 'aaagtgaccgtagcgagctgcatacttccaaaagaagtattgtagaacggggtggtagt';
  $geneRNA = $geneDNA;
  $geneRNA =~ tr/Tt/Uu/;
  $gene = Bio::Seq->new( -seq  => $geneRNA,
                         -id   => "transctibed_gene");
  $DB = Bio::SeqIO->new(-file  => 'theseqs.fa',
                        -format=>'fasta');
  # TCoffee
  @params = ('ktuple' => 2,
             'matrix' => 'BLOSUM',
             'output' => 'clustalw',
             'outfile'=> 'mi.out');
  $factory = new Bio::Tools::Run::Alignment::TCoffee (@params);

   my $mi=$DB->next_seq();
   push (@seq_array, $mi,$gene);
   push (@seq_array, $gene);
   $seq_array_ref = \@seq_array;
   $aln = $factory->align($seq_array_ref);

Thanks in advance for your help!
Sincerely Yours, Victoria R.


----------------------
Силна Анти-спам защита
12MB Място за поща
SMS за нов емeйл и към двата оператора!
POP3/WAP Достъп
_________________________________________
HOB БEЗПЛATEH AДPEC - http://mail.bg/new/