[Bioperl-l] BioPerl problem - can anyone help me?

[Vesko Baev]

>Hello Dear Colleagues,
>I'm a new user of BioPerl!(student in fact)
>My idea is to get the seq obj from multifasta file and align it with ither seq obj.
>I've wrote a simple script for TCoffee program, but when I start the script I've got error message. If I use '$aln = $factory->align($FILE);' every thing is ok (with fasta file).
>but if I use '$aln = $factory->align($seq_array_ref);
>there is a error mesage like this:
>------
>Can't call method "isa" on unblessed reference at D:/Perl/site/lib/Bio/Root/IO.p
>m line 487, <GEN0> chunk 1.
>------
>My script is simple and I can't find where is my error!?:
>
>
>use Bio::Seq;
>use Bio::SeqIO;
>use Bio::Tools::Run::Alignment::TCoffee;
>$ENV{TCOFFEEDIR} = '/perl/tcoffee';
>
>#The gene obj
> $geneDNA = 'aaagtgaccgtagcgagctgcatacttccaaaagaagtattgtagaacggggtggtagt';
> $geneRNA = $geneDNA;
> $geneRNA =~ tr/Tt/Uu/;
> $gene = Bio::Seq->new( -seq => $geneRNA,
> -id => "transctibed_gene");
> $DB = Bio::SeqIO->new(-file => 'theseqs.fa',
> -format=>'fasta');
> # TCoffee
> @params = ('ktuple' => 2,
> 'matrix' => 'BLOSUM',
> 'output' => 'clustalw',
> 'outfile'=> 'mi.out');
> $factory = new Bio::Tools::Run::Alignment::TCoffee (@params);
>
> my $mi=$DB->next_seq();
> push (@seq_array, $mi,$gene);
> push (@seq_array, $gene);
> $seq_array_ref = \@seq_array;
> $aln = $factory->align($seq_array_ref);
>-----------------------
>And when I use :
>while ( my $seq = $DB->next_seq() ) {
> push (@seq_array, $seq) ;}
>my $seq_array_ref = \@seq_array;
>$aln = $factory->align($seq_array_ref);
>Again I have the same error message
>
>I tryed everything, but it works only when I give it the fasta file to align!HELP!
>
>Thanks in advance for your help!
>Sincerely Yours, Vesselin Baev
>Bulgaria


-----------------------------------------------------------------
http://nova.GBG.bg - Направи си сайт! Лесно, бързо и професионално.