[Bioperl-l] TCoffee question?

[Shawn Hoon]

Yes u will need TCoffee installed. bioperl-run is simply a suite of 
perl wrapper modules around the binaries.
The urls to download the programs may be found in  INSTALL.PROGRAMS in 
the bioperl-run package.

shawn

On Sunday, September 7, 2003, at 12:34 AM, Vesko Baev wrote:

> Hi,
> I have some ERROR MESAGES that I don't understand that they mean?
> The sctipt using TCoffee (I've got the run::al.::Tcoffee module, but I 
> do not know if it wants any TCoffee external program ot something like 
> that?!
> there is a script & ERR.messages:
>
>
>
> #!/usr/bin/perl
> use Bio::Seq;
> use Bio::Tools::Run::Alignment::TCoffee;
>
>
> #Build a Bio::Seq obj1
>   $seqobj1 = Bio::Seq->new(-seq      => "gatgggtataataggtggactta");
> #Build a Bio::Seq obj2
>   $gene_seqobj2 = Bio::Seq->new(-seq => "gacgggtatctttaggcggacttag");
>
>
>   # Build a tcoffee alignment factory
>   @params = ('ktuple' => 2,
>              'matrix' => 'BLOSUM',
>              'output' => 'clustalw',
>              'outfile'=> 'coffee.out');
>   $factory = new Bio::Tools::Run::Alignment::TCoffee (@params);
>
> #  WAY ONE with file
> #  $aln = $factory->align('el.fa');
>
> #  WAY TWO with 2 seq obj
>    my @seq_array =();
>
>    push (@seq_array, $seqobj1);
>    push (@seq_array, $gene_seqobj2);
>
>    $seq_array_ref = \@seq_array;
>    $aln = $factory->align($seq_array_ref);
>    my $s1_perid = $aln->average_percentage_identity;
>    print $s1_perid;
>
> in the way with fasta file I've got:
> ------------- EXCEPTION  -------------
> MSG: TCoffee call crashed: 0 [command  
> -in=el.fa,XBLOSUM,Mlalign_id_pair,Mclusta
> lw_pair  -ktuple=2 -outfile=coffee.out -output=clustalw]
>
> STACK Bio::Tools::Run::Alignment::TCoffee::_run 
> D:/Perl/site/lib/Bio/Tools/Run/A
> lignment/TCoffee.pm:814
> STACK Bio::Tools::Run::Alignment::TCoffee::align 
> D:/Perl/site/lib/Bio/Tools/Run/
> Alignment/TCoffee.pm:719
> STACK toplevel coffee.pl:21
>
> --------------------------------------
> in the WAY 2 (with the 2 seqobj) the ERROR MESSAGE i telling me that 
> in my array there is less then 2 seq obj (but I pushed 2 obj!)
>
> THANKS!! AGAIN!
>
>
> -----------------------------------------------------------------
> http://nova.GBG.bg - Направи си сайт! Лесно, бързо и професионално.
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
-shawn