[Bioperl-l] Boxes and features...

Fri Mar 7 13:09:56 EST 2003

Hi,

Most likely you are trying to fetch a tag from the arrow feature that you use 
as the scale at the top of the picture.  You should first check that the tag 
exists before you attempt to call it, or you can use the primary_tag to 
distinguish between different feature types.  The enclosed examples show you 
what to do.

Lincoln

On Thursday 06 March 2003 09:27 am, William Boileau wrote:
> Hi,
>
> I tried to remove the box_subparts option (the hit is what I need, not
> each HSP), but it doesn't seem to work.I still have the error "MSG: asking
> for tag value that does not exist name" I didn't try to add the tag to each
> oh the HSPs, but now I hesitate... How can I do that ? for the moment I add
> each HSP to the feature, but how can i add tags to an HSP ?
> Thanks for your answers ! (and I know I owe you much :) )
>
> William
>
> > Hi William,
> >
> > Sorry I didn't notice this before.  The problem is that you are using
> > the  -box_subparts option when you add the track.  This is telling the
> > track to  return the SUBFEATURES when you call boxes() rather than the
> > top level  features.  So what you're getting from boxes() is the HSP
> > subcomponents,  which don't happen to have tags.
> >
> > You can either:
> >
> > 	1) remove -box_subparts (or set it to 0)
> > 	2) add the tags to each of the HSPs
> >
> > It depends on whether you want clicks to be directed at each HSP or at
> > the hit  as a whole.
> >
> > Lincoln
> >
> >> >> my $track = $panel->add_track(-glyph        => 'graded_segments',
> >> >> 			      -label        => 1,
> >> >> 			      -connector    => 'dashed',
> >> >> 			      -bgcolor      => 'blue',
> >> >> 			      -font2color   => 'red',
> >> >> 			      -sort_order   => 'high_score',
> >> >> 			      -box_subparts => 1,
> >> >> 			      -description  => sub {
> >> >> 				my $feature = shift;
> >> >> 				return unless $feature->has_tag('desription');
> >
> > ========================================================================
> > Lincoln D. Stein                           Cold Spring Harbor
> > Laboratory lstein at cshl.org			                  Cold Spring Harbor, NY
> > ========================================================================
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l at bioperl.org
> > http://bioperl.org/mailman/listinfo/bioperl-l
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l

-- 
========================================================================
Lincoln D. Stein                           Cold Spring Harbor Laboratory
lstein at cshl.org			                  Cold Spring Harbor, NY
========================================================================
-------------- next part --------------
A non-text attachment was scrubbed...
Name: test_blastgraph.pl
Type: text/x-perl
Size: 2547 bytes
Desc: not available
Url : /pipermail/attachments/20030307/5b6cb87f/test_blastgraph.bin
-------------- next part --------------
full_length:

hit:
description	Human non-histone chromatin protein HMG1 (HMG1) gene, complete cds.
name	U51677

hit:
description	Mus musculus (clone Clebp-1) high mobility group 1 protein (HMG-1)
name	L38477

hit:
description	M.musculus HMG1 gene
name	X80457

hit:
description	Mus musculus HMG-1 mRNA, complete cds.
name	U00431

hit:
description	Human non-histone chromosomal protein (HMG-1) retropseudogene.
name	L08048

hit:
description	Human mRNA for high mobility group-1 protein (HMG-1).
name	X12597

hit:
description	Rat amphoterin mRNA, complete cds.
name	M64986

hit:
description	M.musculus mRNA for non-histone chromosomal high-mobility group 1
name	Z11997

hit:
description	Human mRNA for HMG-1, complete cds.
name	D63874

hit:
description	Human DNA sequence from BAC 445C9 on chromosome 22q12.1.
name	Z95115

hit:
description	Bovine mRNA for high mobility group 1 (HMG1) protein
name	X12796

hit:
description	Bovine high-mobility-group protein (HMG-1) mRNA, 3' end.
name	M26110

hit:
description	Mus musculus HMG-like protein (Trf) mRNA, complete cds.
name	AF009343

hit:
description	Pig nonhistone protein HMG1 mRNA, complete cds.
name	M21683;M21684

hit:
description	Homo sapiens (clone 06) high mobility group 1 protein mRNA
name	L13805

hit:
description	Human chromosomal protein HMG1 related gene.
name	D14718

hit:
description	Chinese hamster HMG-1 gene for high mobility group protein 1
name	Y00365

hit:
description	Rat high mobility group 1 protein synthetic gene, complete cds.
name	M63852

hit:
description	Rat mRNA for high mobility group protein HMG1
name	Y00463

hit:
description	M.musculus HMG1-R-227 gene
name	X80466

hit:
description	M.musculus HMG1-R-154 gene
name	X80462

hit:
description	M.musculus HMG1-R-145 gene
name	X80461

hit:
description	M.musculus HMG1-R-177 gene
name	X80459

hit:
description	M.musculus HMG1-R-87 gene
name	X80467

hit:
description	M.musculus HMG1-R-168 gene
name	X80465

hit:
description	M.musculus HMG1-R-159 gene
name	X80463

hit:
description	Rainbow trout HMG-1 gene exons 2-5, complete cds.
name	L32859

hit:
description	M.musculus HMG1-R-135 gene
name	X80460

hit:
description	M.musculus HMG1-R-161 gene
name	X80464

hit:
description	Trout mRNA for high mobility group protein HMG-T
name	X02666

hit:
description	Xenopus laevis high mobility group protein-1 (HMG-1) mRNA, complete
name	U21933

-------------- next part --------------
BLASTN 2.2.1 [Apr-13-2001]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= 
         (1500 letters)

Database: Homo_sapiens.cdna.fa
           27,628 sequences; 54,878,749 total letters

Searching..................................................done

                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

ENST00000001380 Gene:ENSG00000000938 Clone:AL031729 Contig:AL031...  2974  0.0
ENST00000311414 Gene:ENSG00000000938 Clone:AL031729 Contig:AL031...  2712  0.0
ENST00000217351 Gene:ENSG00000101371 Clone:AL133293 Contig:AL133...   147  4e-34
ENST00000229471 Gene:ENSG00000010810 Clone:AL158035 Contig:AL158...    96  1e-18
ENST00000229470 Gene:ENSG00000010810 Clone:Z97989 Contig:Z97989....    96  1e-18
ENST00000012102 Gene:ENSG00000010810 Clone:Z97989 Contig:Z97989....    96  1e-18
ENST00000262651 Gene:ENSG00000101336 Clone:AL353092 Contig:AL353...    86  1e-15
ENST00000259089 Gene:ENSG00000136573 Clone:AF131216 Contig:AF131...    62  2e-08
ENST00000261799 Gene:ENSG00000113721 Clone:AC005895 Contig:AC005...    46  0.001
ENST00000292410 Gene:ENSG00000160867 Clone:AC027314 Contig:AC027...    44  0.004
ENST00000292408 Gene:ENSG00000160867 Clone:AC027314 Contig:AC027...    44  0.004
ENST00000265442 Gene:ENSG00000105976 Clone:AC002080 Contig:AC002...    42  0.017
ENST00000276497 Gene:ENSG00000147507 Clone:AC046176 Contig:AC046...    40  0.067
ENST00000266054 Gene:ENSG00000107566 Clone:AL138921 Contig:AL138...    40  0.067
ENST00000253055 Gene:ENSG00000130758 Clone:AC118344 Contig:AC118...    40  0.067

>ENST00000001380 Gene:ENSG00000000938 Clone:AL031729
            Contig:AL031729.16.1.125287 Chr:1 Basepair:27512639
            Status:known
          Length = 2350

 Score = 2974 bits (1500), Expect = 0.0
 Identities = 1500/1500 (100%)
 Strand = Plus / Plus

Query: 1    gggaggaccccaatctaggcccaagagggaaagccacgtgcctgtatgagcgtatgagca 60
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1    gggaggaccccaatctaggcccaagagggaaagccacgtgcctgtatgagcgtatgagca 60

Query: 61   tgtgcatgcgcgtgtgtgcacagggtggtgcacctggcaggggtccttgagtgaggcatg 120
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 61   tgtgcatgcgcgtgtgtgcacagggtggtgcacctggcaggggtccttgagtgaggcatg 120

Query: 121  ccccattctgtagcagggaacctggaatgggctgtgtgttctgcaagaaattggagccgg 180
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121  ccccattctgtagcagggaacctggaatgggctgtgtgttctgcaagaaattggagccgg 180

Query: 181  tggccacggccaaggaggatgctggcctggaaggggacttcagaagctacggggcagcag 240
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 181  tggccacggccaaggaggatgctggcctggaaggggacttcagaagctacggggcagcag 240

Query: 241  accactatgggcctgaccccactaaggcccggcctgcatcctcatttgcccacatcccca 300
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 241  accactatgggcctgaccccactaaggcccggcctgcatcctcatttgcccacatcccca 300

Query: 301  actacagcaacttctcctctcaggccatcaaccctggcttccttgatagtggcaccatca 360
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 301  actacagcaacttctcctctcaggccatcaaccctggcttccttgatagtggcaccatca 360

Query: 361  ggggtgtgtcagggattggggtgaccctgttcattgccctgtatgactatgaggctcgaa 420
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 361  ggggtgtgtcagggattggggtgaccctgttcattgccctgtatgactatgaggctcgaa 420

Query: 421  ctgaggatgacctcaccttcaccaagggcgagaagttccacatcctgaacaatactgaag 480
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 421  ctgaggatgacctcaccttcaccaagggcgagaagttccacatcctgaacaatactgaag 480

Query: 481  gtgactggtgggaggctcggtctctcagctccggaaaaactggctgcattcccagcaact 540
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 481  gtgactggtgggaggctcggtctctcagctccggaaaaactggctgcattcccagcaact 540

Query: 541  acgtggcccctgttgactcaatccaagctgaagagtggtactttggaaagattgggagaa 600
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 541  acgtggcccctgttgactcaatccaagctgaagagtggtactttggaaagattgggagaa 600

Query: 601  aggatgcagagaggcagctgctttcaccaggcaacccccagggggcctttctcattcggg 660
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 601  aggatgcagagaggcagctgctttcaccaggcaacccccagggggcctttctcattcggg 660

Query: 661  aaagcgagaccaccaaaggtgcctactccctgtccatccgggactgggatcagaccagag 720
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 661  aaagcgagaccaccaaaggtgcctactccctgtccatccgggactgggatcagaccagag 720

Query: 721  gcgatcatgtgaagcattacaagatccgcaaactggacatgggcggctactacatcacca 780
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 721  gcgatcatgtgaagcattacaagatccgcaaactggacatgggcggctactacatcacca 780

Query: 781  cacgggttcagttcaactcggtgcaggagctggtgcagcactacatggaggtgaatgacg 840
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 781  cacgggttcagttcaactcggtgcaggagctggtgcagcactacatggaggtgaatgacg 840

Query: 841  ggctgtgcaacctgctcatcgcgccctgcaccatcatgaagccgcagacgctgggcctgg 900
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 841  ggctgtgcaacctgctcatcgcgccctgcaccatcatgaagccgcagacgctgggcctgg 900

Query: 901  ccaaggacgcctgggagatcagccgcagctccatcacgctggagcgccggctgggcaccg 960
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 901  ccaaggacgcctgggagatcagccgcagctccatcacgctggagcgccggctgggcaccg 960

Query: 961  gctgcttcggggatgtgtggctgggcacgtggaacggcagcactaaggtggcggtgaaga 1020
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 961  gctgcttcggggatgtgtggctgggcacgtggaacggcagcactaaggtggcggtgaaga 1020

Query: 1021 cgctgaagccgggcaccatgtccccgaaggccttcctggaggaggcgcaggtcatgaagc 1080
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1021 cgctgaagccgggcaccatgtccccgaaggccttcctggaggaggcgcaggtcatgaagc 1080

Query: 1081 tgctgcggcacgacaagctggtgcagctgtacgccgtggtgtcggaggagcccatctaca 1140
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1081 tgctgcggcacgacaagctggtgcagctgtacgccgtggtgtcggaggagcccatctaca 1140

Query: 1141 tcgtgaccgagttcatgtgtcacggcagcttgctggattttctcaagaacccagagggcc 1200
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1141 tcgtgaccgagttcatgtgtcacggcagcttgctggattttctcaagaacccagagggcc 1200

Query: 1201 aggatttgaggctgccccaattggtggacatggcagcccaggtagctgagggcatggcct 1260
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1201 aggatttgaggctgccccaattggtggacatggcagcccaggtagctgagggcatggcct 1260

Query: 1261 acatggaacgcatgaactacattcaccgcgacctgagggcagccaacatcctggttgggg 1320
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1261 acatggaacgcatgaactacattcaccgcgacctgagggcagccaacatcctggttgggg 1320

Query: 1321 agcggctggcgtgcaagatcgcagactttggcttggcgcgtctcatcaaggacgatgagt 1380
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1321 agcggctggcgtgcaagatcgcagactttggcttggcgcgtctcatcaaggacgatgagt 1380

Query: 1381 acaacccctgccaaggttccaagttccccatcaagtggacagccccagaagctgccctct 1440
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1381 acaacccctgccaaggttccaagttccccatcaagtggacagccccagaagctgccctct 1440

Query: 1441 ttggcagattcaccatcaagtcagacgtgtggtcctttgggatcctgctcactgagctca 1500
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1441 ttggcagattcaccatcaagtcagacgtgtggtcctttgggatcctgctcactgagctca 1500

>ENST00000311414 Gene:ENSG00000000938 Clone:AL031729
            Contig:AL031729.16.1.125287 Chr:1 Basepair:27512639
            Status:known
          Length = 2060

 Score = 2712 bits (1368), Expect = 0.0
 Identities = 1368/1368 (100%)
 Strand = Plus / Plus

Query: 133  gcagggaacctggaatgggctgtgtgttctgcaagaaattggagccggtggccacggcca 192
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 171  gcagggaacctggaatgggctgtgtgttctgcaagaaattggagccggtggccacggcca 230

Query: 193  aggaggatgctggcctggaaggggacttcagaagctacggggcagcagaccactatgggc 252
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 231  aggaggatgctggcctggaaggggacttcagaagctacggggcagcagaccactatgggc 290

Query: 253  ctgaccccactaaggcccggcctgcatcctcatttgcccacatccccaactacagcaact 312
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 291  ctgaccccactaaggcccggcctgcatcctcatttgcccacatccccaactacagcaact 350

Query: 313  tctcctctcaggccatcaaccctggcttccttgatagtggcaccatcaggggtgtgtcag 372
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 351  tctcctctcaggccatcaaccctggcttccttgatagtggcaccatcaggggtgtgtcag 410

Query: 373  ggattggggtgaccctgttcattgccctgtatgactatgaggctcgaactgaggatgacc 432
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 411  ggattggggtgaccctgttcattgccctgtatgactatgaggctcgaactgaggatgacc 470

Query: 433  tcaccttcaccaagggcgagaagttccacatcctgaacaatactgaaggtgactggtggg 492
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 471  tcaccttcaccaagggcgagaagttccacatcctgaacaatactgaaggtgactggtggg 530

Query: 493  aggctcggtctctcagctccggaaaaactggctgcattcccagcaactacgtggcccctg 552
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 531  aggctcggtctctcagctccggaaaaactggctgcattcccagcaactacgtggcccctg 590

Query: 553  ttgactcaatccaagctgaagagtggtactttggaaagattgggagaaaggatgcagaga 612
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 591  ttgactcaatccaagctgaagagtggtactttggaaagattgggagaaaggatgcagaga 650

Query: 613  ggcagctgctttcaccaggcaacccccagggggcctttctcattcgggaaagcgagacca 672
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 651  ggcagctgctttcaccaggcaacccccagggggcctttctcattcgggaaagcgagacca 710

Query: 673  ccaaaggtgcctactccctgtccatccgggactgggatcagaccagaggcgatcatgtga 732
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 711  ccaaaggtgcctactccctgtccatccgggactgggatcagaccagaggcgatcatgtga 770

Query: 733  agcattacaagatccgcaaactggacatgggcggctactacatcaccacacgggttcagt 792
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 771  agcattacaagatccgcaaactggacatgggcggctactacatcaccacacgggttcagt 830

Query: 793  tcaactcggtgcaggagctggtgcagcactacatggaggtgaatgacgggctgtgcaacc 852
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 831  tcaactcggtgcaggagctggtgcagcactacatggaggtgaatgacgggctgtgcaacc 890

Query: 853  tgctcatcgcgccctgcaccatcatgaagccgcagacgctgggcctggccaaggacgcct 912
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 891  tgctcatcgcgccctgcaccatcatgaagccgcagacgctgggcctggccaaggacgcct 950

Query: 913  gggagatcagccgcagctccatcacgctggagcgccggctgggcaccggctgcttcgggg 972
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 951  gggagatcagccgcagctccatcacgctggagcgccggctgggcaccggctgcttcgggg 1010

Query: 973  atgtgtggctgggcacgtggaacggcagcactaaggtggcggtgaagacgctgaagccgg 1032
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1011 atgtgtggctgggcacgtggaacggcagcactaaggtggcggtgaagacgctgaagccgg 1070

Query: 1033 gcaccatgtccccgaaggccttcctggaggaggcgcaggtcatgaagctgctgcggcacg 1092
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1071 gcaccatgtccccgaaggccttcctggaggaggcgcaggtcatgaagctgctgcggcacg 1130

Query: 1093 acaagctggtgcagctgtacgccgtggtgtcggaggagcccatctacatcgtgaccgagt 1152
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1131 acaagctggtgcagctgtacgccgtggtgtcggaggagcccatctacatcgtgaccgagt 1190

Query: 1153 tcatgtgtcacggcagcttgctggattttctcaagaacccagagggccaggatttgaggc 1212
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1191 tcatgtgtcacggcagcttgctggattttctcaagaacccagagggccaggatttgaggc 1250

Query: 1213 tgccccaattggtggacatggcagcccaggtagctgagggcatggcctacatggaacgca 1272
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1251 tgccccaattggtggacatggcagcccaggtagctgagggcatggcctacatggaacgca 1310

Query: 1273 tgaactacattcaccgcgacctgagggcagccaacatcctggttggggagcggctggcgt 1332
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1311 tgaactacattcaccgcgacctgagggcagccaacatcctggttggggagcggctggcgt 1370

Query: 1333 gcaagatcgcagactttggcttggcgcgtctcatcaaggacgatgagtacaacccctgcc 1392
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1371 gcaagatcgcagactttggcttggcgcgtctcatcaaggacgatgagtacaacccctgcc 1430

Query: 1393 aaggttccaagttccccatcaagtggacagccccagaagctgccctctttggcagattca 1452
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1431 aaggttccaagttccccatcaagtggacagccccagaagctgccctctttggcagattca 1490

Query: 1453 ccatcaagtcagacgtgtggtcctttgggatcctgctcactgagctca 1500
            ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 1491 ccatcaagtcagacgtgtggtcctttgggatcctgctcactgagctca 1538

>ENST00000217351 Gene:ENSG00000101371 Clone:AL133293
            Contig:AL133293.28.1.68662 Chr:20 Basepair:35741025
            Status:known
          Length = 3668

 Score =  147 bits (74), Expect = 4e-34
 Identities = 206/250 (82%)
 Strand = Plus / Plus

Query: 1251 ggcatggcctacatggaacgcatgaactacattcaccgcgacctgagggcagccaacatc 1310
            |||||||| ||| |||| || ||||||||| | ||||| |||||  | ||||||||||||
Sbjct: 1144 ggcatggcgtacgtggagcggatgaactacgtccaccgggaccttcgtgcagccaacatc 1203

Query: 1311 ctggttggggagcggctggcgtgcaagatcgcagactttggcttggcgcgtctcatcaag 1370
            ||||| || |||   |||| ||||||  | || ||||||||  |||| || |||||  | 
Sbjct: 1204 ctggtgggagagaacctggtgtgcaaagtggcggactttgggctggctcggctcattgaa 1263

Query: 1371 gacgatgagtacaacccctgccaaggttccaagttccccatcaagtggacagccccagaa 1430
            ||| |||||||||   |  | |||||| |||| ||||||||||||||||| || ||||||
Sbjct: 1264 gacaatgagtacacggcgcggcaaggtgccaaattccccatcaagtggacggctccagaa 1323

Query: 1431 gctgccctctttggcagattcaccatcaagtcagacgtgtggtcctttgggatcctgctc 1490
            |||||||||| |||| | |||||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 1324 gctgccctctatggccgcttcaccatcaagtcggacgtgtggtccttcgggatcctgctg 1383

Query: 1491 actgagctca 1500
            ||||||||||
Sbjct: 1384 actgagctca 1393

 Score =  111 bits (56), Expect = 2e-23
 Identities = 185/228 (81%)
 Strand = Plus / Plus

Query: 960  ggctgcttcggggatgtgtggctgggcacgtggaacggcagcactaaggtggcggtgaag 1019
            |||||||| || || |||||| |||| || |||||||| | ||| | ||||||  | || 
Sbjct: 853  ggctgctttggcgaggtgtggatggggacctggaacggtaccaccagggtggccatcaaa 912

Query: 1020 acgctgaagccgggcaccatgtccccgaaggccttcctggaggaggcgcaggtcatgaag 1079
            || |||||||| ||||| ||||| ||  ||||||||||| ||||||| ||||||||||||
Sbjct: 913  accctgaagcctggcacgatgtctccagaggccttcctgcaggaggcccaggtcatgaag 972

Query: 1080 ctgctgcggcacgacaagctggtgcagctgtacgccgtggtgtcggaggagcccatctac 1139
              |||| |||| || |||||||||||| |||| || ||||| || ||||||||||| |||
Sbjct: 973  aagctgaggcatgagaagctggtgcagttgtatgctgtggtttcagaggagcccatttac 1032

Query: 1140 atcgtgaccgagttcatgtgtcacggcagcttgctggattttctcaag 1187
            ||||| || |||| |||| |  | || || |||||||| |||||||||
Sbjct: 1033 atcgtcacggagtacatgagcaaggggagtttgctggactttctcaag 1080

 Score = 61.9 bits (31), Expect = 2e-08
 Identities = 46/51 (90%)
 Strand = Plus / Plus

Query: 729 gtgaagcattacaagatccgcaaactggacatgggcggctactacatcacc 779
           |||||||| |||||||||||||| |||||||  ||||||| ||||||||||
Sbjct: 622 gtgaagcactacaagatccgcaagctggacagcggcggcttctacatcacc 672

 Score = 60.0 bits (30), Expect = 7e-08
 Identities = 39/42 (92%)
 Strand = Plus / Plus

Query: 879 aagccgcagacgctgggcctggccaaggacgcctgggagatc 920
           ||||||||||| | ||||||||||||||| ||||||||||||
Sbjct: 772 aagccgcagactcagggcctggccaaggatgcctgggagatc 813

 Score = 46.1 bits (23), Expect = 0.001
 Identities = 59/71 (83%)
 Strand = Plus / Plus

Query: 522 ggctgcattcccagcaactacgtggcccctgttgactcaatccaagctgaagagtggtac 581
           |||| ||| ||||||||||||||||| ||    ||||| ||||| ||||| |||||||| 
Sbjct: 415 ggctacatccccagcaactacgtggcgccctccgactccatccaggctgaggagtggtat 474

Query: 582 tttggaaagat 592
           ||||| |||||
Sbjct: 475 tttggcaagat 485

 Score = 40.1 bits (20), Expect = 0.067
 Identities = 26/28 (92%)
 Strand = Plus / Plus

Query: 660 gaaagcgagaccaccaaaggtgcctact 687
           ||||| |||||||| |||||||||||||
Sbjct: 553 gaaagtgagaccacgaaaggtgcctact 580

>ENST00000229471 Gene:ENSG00000010810 Clone:AL158035
            Contig:AL158035.14.1.218548 Chr:6 Basepair:111817882
            Status:known
          Length = 2328

 Score = 95.6 bits (48), Expect = 1e-18
 Identities = 87/100 (87%)
 Strand = Plus / Plus

Query: 1053 ttcctggaggaggcgcaggtcatgaagctgctgcggcacgacaagctggtgcagctgtac 1112
            ||||| ||||| |||||| ||||||||  ||||  ||||||||||||||| ||||| || 
Sbjct: 1271 ttccttgaggaagcgcagatcatgaagaagctgaagcacgacaagctggtccagctctat 1330

Query: 1113 gccgtggtgtcggaggagcccatctacatcgtgaccgagt 1152
            || |||||||| |||||||||||||||||||| |||||||
Sbjct: 1331 gcagtggtgtctgaggagcccatctacatcgtcaccgagt 1370

 Score = 69.9 bits (35), Expect = 7e-11
 Identities = 89/107 (83%)
 Strand = Plus / Plus

Query: 1392 caaggttccaagttccccatcaagtggacagccccagaagctgccctctttggcagattc 1451
            |||||| | |||||||||||||||||||| ||||| || || ||||| |  || || |||
Sbjct: 1610 caaggtgcaaagttccccatcaagtggacggcccccgaggcagccctgtacgggaggttc 1669

Query: 1452 accatcaagtcagacgtgtggtcctttgggatcctgctcactgagct 1498
            || |||||||| ||||||||||| ||||| ||| | ||||| |||||
Sbjct: 1670 acaatcaagtctgacgtgtggtcttttggaatcttactcacagagct 1716

 Score = 69.9 bits (35), Expect = 7e-11
 Identities = 56/63 (88%)
 Strand = Plus / Plus

Query: 527 cattcccagcaactacgtggcccctgttgactcaatccaagctgaagagtggtactttgg 586
           |||||||||||| || ||||| || |||||||| ||||| || |||||||||||||||||
Sbjct: 736 cattcccagcaattatgtggctccagttgactctatccaggcagaagagtggtactttgg 795

Query: 587 aaa 589
           |||
Sbjct: 796 aaa 798

 Score = 42.1 bits (21), Expect = 0.017
 Identities = 45/53 (84%)
 Strand = Plus / Plus

Query: 1224 gtggacatggcagcccaggtagctgagggcatggcctacatggaacgcatgaa 1276
            |||||||||||||| ||||| ||||  || ||||| ||||| || ||||||||
Sbjct: 1442 gtggacatggcagcacaggtggctgcaggaatggcttacatcgagcgcatgaa 1494

>ENST00000229470 Gene:ENSG00000010810 Clone:Z97989
            Contig:Z97989.1.1.155937 Chr:6 Basepair:111817882
            Status:known
          Length = 1695

 Score = 95.6 bits (48), Expect = 1e-18
 Identities = 87/100 (87%)
 Strand = Plus / Plus

Query: 1053 ttcctggaggaggcgcaggtcatgaagctgctgcggcacgacaagctggtgcagctgtac 1112
            ||||| ||||| |||||| ||||||||  ||||  ||||||||||||||| ||||| || 
Sbjct: 1012 ttccttgaggaagcgcagatcatgaagaagctgaagcacgacaagctggtccagctctat 1071

Query: 1113 gccgtggtgtcggaggagcccatctacatcgtgaccgagt 1152
            || |||||||| |||||||||||||||||||| |||||||
Sbjct: 1072 gcagtggtgtctgaggagcccatctacatcgtcaccgagt 1111

 Score = 69.9 bits (35), Expect = 7e-11
 Identities = 89/107 (83%)
 Strand = Plus / Plus

Query: 1392 caaggttccaagttccccatcaagtggacagccccagaagctgccctctttggcagattc 1451
            |||||| | |||||||||||||||||||| ||||| || || ||||| |  || || |||
Sbjct: 1351 caaggtgcaaagttccccatcaagtggacggcccccgaggcagccctgtacgggaggttc 1410

Query: 1452 accatcaagtcagacgtgtggtcctttgggatcctgctcactgagct 1498
            || |||||||| ||||||||||| ||||| ||| | ||||| |||||
Sbjct: 1411 acaatcaagtctgacgtgtggtcttttggaatcttactcacagagct 1457

 Score = 42.1 bits (21), Expect = 0.017
 Identities = 45/53 (84%)
 Strand = Plus / Plus

Query: 1224 gtggacatggcagcccaggtagctgagggcatggcctacatggaacgcatgaa 1276
            |||||||||||||| ||||| ||||  || ||||| ||||| || ||||||||
Sbjct: 1183 gtggacatggcagcacaggtggctgcaggaatggcttacatcgagcgcatgaa 1235

>ENST00000012102 Gene:ENSG00000010810 Clone:Z97989
            Contig:Z97989.1.1.155937 Chr:6 Basepair:111817882
            Status:known
          Length = 1602

 Score = 95.6 bits (48), Expect = 1e-18
 Identities = 87/100 (87%)
 Strand = Plus / Plus

Query: 1053 ttcctggaggaggcgcaggtcatgaagctgctgcggcacgacaagctggtgcagctgtac 1112
            ||||| ||||| |||||| ||||||||  ||||  ||||||||||||||| ||||| || 
Sbjct: 922  ttccttgaggaagcgcagatcatgaagaagctgaagcacgacaagctggtccagctctat 981

Query: 1113 gccgtggtgtcggaggagcccatctacatcgtgaccgagt 1152
            || |||||||| |||||||||||||||||||| |||||||
Sbjct: 982  gcagtggtgtctgaggagcccatctacatcgtcaccgagt 1021

 Score = 69.9 bits (35), Expect = 7e-11
 Identities = 89/107 (83%)
 Strand = Plus / Plus

Query: 1392 caaggttccaagttccccatcaagtggacagccccagaagctgccctctttggcagattc 1451
            |||||| | |||||||||||||||||||| ||||| || || ||||| |  || || |||
Sbjct: 1261 caaggtgcaaagttccccatcaagtggacggcccccgaggcagccctgtacgggaggttc 1320

Query: 1452 accatcaagtcagacgtgtggtcctttgggatcctgctcactgagct 1498
            || |||||||| ||||||||||| ||||| ||| | ||||| |||||
Sbjct: 1321 acaatcaagtctgacgtgtggtcttttggaatcttactcacagagct 1367

 Score = 69.9 bits (35), Expect = 7e-11
 Identities = 56/63 (88%)
 Strand = Plus / Plus

Query: 527 cattcccagcaactacgtggcccctgttgactcaatccaagctgaagagtggtactttgg 586
           |||||||||||| || ||||| || |||||||| ||||| || |||||||||||||||||
Sbjct: 396 cattcccagcaattatgtggctccagttgactctatccaggcagaagagtggtactttgg 455

Query: 587 aaa 589
           |||
Sbjct: 456 aaa 458

 Score = 42.1 bits (21), Expect = 0.017
 Identities = 45/53 (84%)
 Strand = Plus / Plus

Query: 1224 gtggacatggcagcccaggtagctgagggcatggcctacatggaacgcatgaa 1276
            |||||||||||||| ||||| ||||  || ||||| ||||| || ||||||||
Sbjct: 1093 gtggacatggcagcacaggtggctgcaggaatggcttacatcgagcgcatgaa 1145

>ENST00000262651 Gene:ENSG00000101336 Clone:AL353092
            Contig:AL353092.6.1.25010 Chr:20 Basepair:30428114
            Status:known
          Length = 2089

 Score = 85.7 bits (43), Expect = 1e-15
 Identities = 79/91 (86%)
 Strand = Plus / Plus

Query: 1399 ccaagttccccatcaagtggacagccccagaagctgccctctttggcagattcaccatca 1458
            ||||||||||||||||||||||||| || |||||   |  |||||||   ||||||||||
Sbjct: 1421 ccaagttccccatcaagtggacagctcctgaagccatcaactttggctccttcaccatca 1480

Query: 1459 agtcagacgtgtggtcctttgggatcctgct 1489
            |||||||||| ||||||||||| ||||||||
Sbjct: 1481 agtcagacgtctggtcctttggtatcctgct 1511

 Score = 40.1 bits (20), Expect = 0.067
 Identities = 29/32 (90%)
 Strand = Plus / Plus

Query: 1126 aggagcccatctacatcgtgaccgagttcatg 1157
            ||||||||||||||||| | || |||||||||
Sbjct: 1148 aggagcccatctacatcatcacggagttcatg 1179

  Database: Homo_sapiens.cdna.fa
    Posted date:  Dec 5, 2002  2:33 PM
  Number of letters in database: 54,878,749
  Number of sequences in database:  27,628

Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 

Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,768,408
Number of Sequences: 27628
Number of extensions: 5768408
Number of successful extensions: 1106
Number of sequences better than 1.0e-01: 15
length of query: 1500
length of database: 54,878,749
effective HSP length: 18
effective length of query: 1482
effective length of database: 54,381,445
effective search space: 80593301490
effective search space used: 80593301490
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)