[Bioperl-l] 0.6.2 and /examples

[Ewan Birney]

On Tue, 3 Oct 2000, Ewan Birney wrote:

> On Mon, 2 Oct 2000, Clay Shirky wrote:
> 
> > I've installed 0.6.2pre3 on both Linux (Caldera 2.3) and Solaris (2.4)
> > with no problems (though I think the README should reference
> > IO-stringy as a possible external dependency, at least according to
> > /examples/blast/blast_seq.pl).
> > 


Will do.

> > However, having installed it (and trying to teach myself bioperl as I
> > go), I have run into some warnings and exceptions in /examples.
> > 
> > I am happy to fix these scripts (and add some comments to help other
> > newcomers) if anyone can give me some pointers on how to re-write
> > around these error conditions.
> 
> Geez. I was *convinced* I had squashed these bugs. Oh vey! 
> 
> many thanks...
> 

Ok. I can't replicate this:

riker:~/src/bioperl-0.6.2pre3/examples> perl rev_and_trans.pl
Reversed sequence as a string is
[AGGAGACTCTGACTTAGACATGACGGCAGGGTGAAGAGAGACTTTAACGATGCTTCTTCGGCG]
>myseq
AGGAGACTCTGACTTAGACATGACGGCAGGGTGAAGAGAGACTTTAACGATGCTTCTTCG
GCG
Translated sequence!
>myseq
RRRSIVKVSLHPAVMSKSESP


and everything looks kosher. Are  you sure you are not using an old
examples/ script?


> 
> > 
> > With "examples/rev_and_trans.pl" I get
> > 
> >   -------------------- WARNING --------------------
> >   MSG: ./rev_and_trans.pl:35 Seq::str - deprecated method. You should
> >   use $obj->seq in preference
> >   -------------------------------------------------
> > 
> > and
> > 
> >   -------------------- WARNING --------------------
> >   MSG: ./rev_and_trans.pl:41 Seq::out_fasta - deprecated method. You
> >   should use the SeqIO package in preference
> >   -------------------------------------------------
> > 
> > and with "examples/psw.pl" in the blosum alignment I get
> > 
> >   -------------------- WARNING --------------------
> >   MSG: /usr/local/lib/perl5/site_perl/5.005/Bio/Tools/pSW.pm:199
> >   Seq::str - deprecated method. You should use $obj->seq in preference
> >   -------------------------------------------------
> > 
> > and with gonnet I get
> > 
> >   -------------------- EXCEPTION --------------------
> >   MSG: Unable to process non locatable sequences
> >   CONTEXT: Error in uNKNOWN CONTEXT
> >   SCRIPT: ./psw.pl
> >   STACK:
> >   Bio::SimpleAlign::addSeq(177)
> >   Bio::Tools::pSW::pairwise_alignment(265)
> >   main::./psw.pl(122)
> >   ---------------------------------------------------
> > 
> > -clay
> > 
> > --
> > Clay Shirky                 |    shirky.com - Essays on the Internet:
> > http://www.shirky.com/      |        Culture, Economics, Globalization
> > 
> > 
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@bioperl.org
> > http://bioperl.org/mailman/listinfo/bioperl-l
> > 
> 
> -----------------------------------------------------------------
> Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
> <birney@ebi.ac.uk>. 
> -----------------------------------------------------------------
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l
> 

-----------------------------------------------------------------
Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
<birney@ebi.ac.uk>. 
-----------------------------------------------------------------