[Bioperl-l] Fwd: blast result not matching.

[Fields, Christopher J]

Submissions to NCBI BLAST via their web interface have different parameters than those submitted via their QBLAST interface (what is used in BioPerl).  So the fact there are differing results isn't too surprising, particularly if the results fall close to the e-value cutoff for one or the other.  You will need to set the proper parameters, which I don't believe is possible via the (very simple) Bio::Perl interface, but is possible via Bio::Tools::Run::RemoteBlast.

chris

On Sep 8, 2011, at 1:11 AM, Manju Rawat wrote:

> Toady i installed the latest version of bioperl in my system via CPAN..
> But this still not sowing the complete result..
> 
> 
> I just want to do nucleotide blast using bioperl..but while i am doing blast with my sequence it shwowing very samll result..
> I dnt know whether it is wrong or right...but while i am blasting the same sequence in NCBI it showing a diffrent result..
> 
> and i have also tried to use the orignl module..but it also dnt work..
> 
> Pl see reult of the balst in  attached file of this mail..
> #!usr/bin/perl -w
> use Bio::Perl;
> use Bio::SearchIO;
> $blast_report =blast_sequence('acggctgctgtagatctgatgct');
> write_blast(">resl.blast",$blast_report);
> 
> Thanks.
> Manju Rawat
> 
> 
> <resl.blast>