[Bioperl-l] Fwd: blast result not matching.
Manju Rawat
manju.rawat2 at gmail.com
Thu Sep 8 06:11:12 UTC 2011
Toady i installed the latest version of bioperl in my system via CPAN..
But this still not sowing the complete result..
I just want to do nucleotide blast using bioperl..but while i am doing blast
with my sequence it shwowing very samll result..
I dnt know whether it is wrong or right...but while i am blasting the same
sequence in NCBI it showing a diffrent result..
and i have also tried to use the orignl module..but it also dnt work..
Pl see reult of the balst in attached file of this mail..
#!usr/bin/perl -w
use Bio::Perl;
use Bio::SearchIO;
$blast_report =blast_sequence('acggctgctgtagatctgatgct');
write_blast(">resl.blast",$blast_report);
Thanks.
Manju Rawat
-------------- next part --------------
A non-text attachment was scrubbed...
Name: resl.blast
Type: application/octet-stream
Size: 1680 bytes
Desc: not available
URL: <http://lists.open-bio.org/pipermail/bioperl-l/attachments/20110908/28beec67/attachment-0004.obj>
More information about the Bioperl-l
mailing list