[Bioperl-l] Bioperl

[debutant.bioperl]

Dave Messina-3 wrote:
> 
> Um, this sounds an awful lot like homework to me.
> 
> 
> Dave
> 
> 
> On Wed, May 4, 2011 at 15:51, debutant.bioperl
> <joyeux2000 at hotmail.fr>wrote:
> 
>>
>> Good morning,
>> I download a file containing the upstream sequences of genes from a
>> database.
>> these sequences are in FASTA format.
>> explanatory example of sequence :
>> > XX1G56520 | :2695538-2696537 FORWARD CHR1 LENGTH =
>> > 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG> YY1G56520 |
>> > :2695538-2696539 FORWARD CHR1 LENGTH =
>> > 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG ....
>> I want to write code in Bioperl that :
>> *reads the file containing the sequences (you can open it with notepad,
>> Word
>> ...)
>> *looking for a pattern  (eg. GAGAGAGATCGA)
>> *gives what is this gene sequence (eg the pattern italic we note gene
>> code
>> "XX1G56520. ID, which is just past the sign"> "before the pattern)
>> *determines the position of this motif from the start codon, otherwise
>> count
>> the letter starting with the first letter pattern until the last letter
>> before the sign ">" Next.
>> *give the results as a table containing the code for each gene and the
>> position corresponding pattern (number of letters to find plus a negative
>> sign  "- ")
>> if you want more explanation I am always at your disposal.
>> Please help me is urgent %-|
>> cordially
>> --
>> View this message in context:
>> http://old.nabble.com/Bioperl-tp31542007p31542007.html
>> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
%-|%-|
-- 
View this message in context: http://old.nabble.com/Bioperl-tp31542007p31542491.html
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.