[Bioperl-l] Bioperl

[debutant.bioperl]

please help me world, help me even with simples ideas :-(

Chris Fields-5 wrote:
> 
> Yep.  Strange that, being the end of the academic year is upon us... :)
> 
> chris
> 
> On May 4, 2011, at 9:21 AM, Dave Messina wrote:
> 
>> Um, this sounds an awful lot like homework to me.
>> 
>> 
>> Dave
>> 
>> 
>> On Wed, May 4, 2011 at 15:51, debutant.bioperl
>> <joyeux2000 at hotmail.fr>wrote:
>> 
>>> 
>>> Good morning,
>>> I download a file containing the upstream sequences of genes from a
>>> database.
>>> these sequences are in FASTA format.
>>> explanatory example of sequence :
>>>> XX1G56520 | :2695538-2696537 FORWARD CHR1 LENGTH =
>>>> 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG> YY1G56520 |
>>>> :2695538-2696539 FORWARD CHR1 LENGTH =
>>>> 500ATCGATCGATCGATCGGAGAGAGATCGATCGATCGATCGATCG ....
>>> I want to write code in Bioperl that :
>>> *reads the file containing the sequences (you can open it with notepad,
>>> Word
>>> ...)
>>> *looking for a pattern  (eg. GAGAGAGATCGA)
>>> *gives what is this gene sequence (eg the pattern italic we note gene
>>> code
>>> "XX1G56520. ID, which is just past the sign"> "before the pattern)
>>> *determines the position of this motif from the start codon, otherwise
>>> count
>>> the letter starting with the first letter pattern until the last letter
>>> before the sign ">" Next.
>>> *give the results as a table containing the code for each gene and the
>>> position corresponding pattern (number of letters to find plus a
>>> negative
>>> sign  "- ")
>>> if you want more explanation I am always at your disposal.
>>> Please help me is urgent %-|
>>> cordially
>>> --
>>> View this message in context:
>>> http://old.nabble.com/Bioperl-tp31542007p31542007.html
>>> Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.
>>> 
>>> _______________________________________________
>>> Bioperl-l mailing list
>>> Bioperl-l at lists.open-bio.org
>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>> 
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
> 
> 

-- 
View this message in context: http://old.nabble.com/Bioperl-tp31542007p31542480.html
Sent from the Perl - Bioperl-L mailing list archive at Nabble.com.