[Bioperl-l] bioperl graphics

[Scott Cain]

Hello Shachi,

Can you describe in more detail what it is you want to see?  And is
this something that you'll want to generally do for any number of
random sequences?  How do you identify the region you want to
highlight?

Scott


On Wed, Jun 1, 2011 at 5:25 AM, Shachi Gahoi <shachigahoimbi at gmail.com> wrote:
> Dear All,
>
> I have one sequence
> 'ACCTTCTGTTTTCAGCAAGTAGGGTCTTATAACCTTCAAAGAAATATTCCTTCAA'
>
> and now I want to highlight (graphically),  sequence portion of this
> sequence starting from position 15 to 35. How can i do this with bioperl.
>
> If anyone know please tell me.
>
>
> Thanks in advance.
>
> --
> Regards,
> Shachi
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>



-- 
------------------------------------------------------------------------
Scott Cain, Ph. D.                                   scott at scottcain dot net
GMOD Coordinator (http://gmod.org/)                     216-392-3087
Ontario Institute for Cancer Research