[Bioperl-l] bioperl graphics

Shachi Gahoi shachigahoimbi at gmail.com
Wed Jun 1 09:25:50 UTC 2011


Dear All,

I have one sequence
'ACCTTCTGTTTTCAGCAAGTAGGGTCTTATAACCTTCAAAGAAATATTCCTTCAA'

and now I want to highlight (graphically),  sequence portion of this
sequence starting from position 15 to 35. How can i do this with bioperl.

If anyone know please tell me.


Thanks in advance.

-- 
Regards,
Shachi



More information about the Bioperl-l mailing list