[Bioperl-l] OK for aa seq but not a na seq on RemoteBlast.pm version 1.28
Chris Fields
cjfields at uiuc.edu
Thu Feb 16 12:51:50 UTC 2006
Yeah, looks like it broke text output nucleotide parsing with that.
XML output parsing still works though (as expected). I'll give it a
look.
Chris
On Feb 16, 2006, at 3:46 AM, Pieter Monsieurs wrote:
> Hi,
>
> I have the same problem with the blast.pm-file.
> The people of NCBI added some extra info when giving the Blast-
> output. (see e.g. "Features flanking this part..." or "Features in
> this part ..."), example added.
> The blast.pm module starts looking for the hsp-alignement-
> information, but it dies when it hits this Feature-information.
>
> Pieter
>
>
>> gi|77552765|gb|DP000011.1| <http://www.ncbi.nlm.nih.gov/entrez/
>> query.fcgi?
>> cmd=Retrieve&db=Nucleotide&list_uids=77552765&dopt=GenBank> Oryza
>> sativa (japonica cultivar-group) chromosome 12, complete
>
> sequence
> Length=27492551
>
> Features flanking this part of subject sequence:
> 3726 bp at 5' side: transposon protein, putative, CACTA, En/Spm
> sub-class <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=19251479&to=19253693&view=gbwithparts>
> 2655 bp at 3' side: hypothetical protein <http://
> www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=19260091&to=19260600&view=gbwithparts>
>
> Score = 36.2 bits (18), Expect = 0.22
> Identities = 18/18 (100%), Gaps = 0/18 (0%)
> Strand=Plus/Minus
>
> Query 4 GTACTACTCTACTCTACT 21
> ||||||||||||||||||
>
> Sbjct 19257436 GTACTACTCTACTCTACT 19257419
>
>
> Features flanking this part of subject sequence:
> 2991 bp at 5' side: hypothetical protein <http://
> www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=27003164&to=27003907&view=gbwithparts>
> 1131 bp at 3' side: hypothetical protein
> <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=27008046&to=27010752&view=gbwithparts>
>
> Score = 36.2 bits (18), Expect = 0.22
> Identities = 18/18 (100%), Gaps = 0/18 (0%)
> Strand=Plus/Minus
>
> Query 2 ATGTACTACTCTACTCTA 19
> ||||||||||||||||||
> Sbjct 27006915 ATGTACTACTCTACTCTA 27006898
>
>
>
> Features in this part of subject sequence:
> DHHC zinc finger domain, putative
> <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=17614825&to=17618687&view=gbwithparts>
>
> Score = 34.2 bits (17), Expect = 0.87
> Identities = 17/17 (100%), Gaps = 0/17 (0%)
> Strand=Plus/Plus
>
> Query 5 TACTACTCTACTCTACT 21
> |||||||||||||||||
> Sbjct 17616437 TACTACTCTACTCTACT 17616453
>
>
>
> Features flanking this part of subject sequence:
> 102 bp at 5' side: bZIP transcription factor, putative
> <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=2774964&to=2775778&view=gbwithparts>
> 3740 bp at 3' side: yeast dcp1, putative <http://
> www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=2779635&to=2782508&view=gbwithparts>
>
> Score = 32.2 bits (16), Expect = 3.4
> Identities = 16/16 (100%), Gaps = 0/16 (0%)
> Strand=Plus/Plus
>
> Query 7 CTACTCTACTCTACTC 22
> ||||||||||||||||
> Sbjct 2775880 CTACTCTACTCTACTC 2775895
>
>
> Features flanking this part of subject sequence:
>
> 21 bp at 5' side: peptide transporter T17F3.11, putative <http://
> www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=27321354&to=27323117&view=gbwithparts>
> 10230 bp at 3' side: transposon protein, putative, unclassified
> <http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi?
> val=77552765&db=Nucleotide&from=27333383&to=27334285&view=gbwithparts>
>
> Score = 32.2 bits (16), Expect = 3.4
> Identities = 16/16 (100%), Gaps = 0/16 (0%)
> Strand=Plus/Minus
>
> Query 7 CTACTCTACTCTACTC 22
>
> ||||||||||||||||
> Sbjct 27323153 CTACTCTACTCTACTC 27323138
>
>
>
>
> Guojun Yang wrote:
>
>> Hi, Chris,
>> Finally the remoteblast test script works for the amino.fa query.
>> but when I try a nucleic acid sequence (see below), Error occurs: "
>> waiting........
>> ------------- EXCEPTION -------------
>> MSG: no data for midline Features flanking this part of subject
>> sequence:
>> STACK Bio::SearchIO::blast::next_result /usr/lib/perl5/site_perl/
>> 5.8.3/Bio/Searc hIO/blast.pm:1172
>> STACK toplevel remoteblast_test:40
>> "
>> The query sequence is:
>> CTCCCTCCGTCTCAAAATATTTGACGCCGTTGACTTTTTACTAAAAATGTTTGACCGTTC
>> GTCTTATTTAAAAAATTTAAGTAATTATTAATTCTTTTCCTATCATTTGATTTATTGTTA
>> AATATATTTTTATGTATACATATAGTTTTACATATTTCACAAAAAATTTTGAATAAGACG
>> AACGGTCAAATATGTTTTAAAAAGTCAACGGTGTCAAACATTTAGAAACGGAGGGAG
>>
>> The script (basically same as the remoteblast test, I only changed
>> database to 'nr' and program to 'blastn' and filename to 'ost3'):
>> #!/usr/bin/perl
>>
>> use Bio::SeqIO;
>> use Bio::Seq;
>> use Bio::Tools::Run::RemoteBlast;
>> use Bio::SearchIO;
>> use strict;
>> my $prog='blastn';
>> my $db='nr';
>> my $e_val=1e-10;
>> my @params=( -prog=>$prog,
>> -data=>$db,
>> -expect=>$e_val,
>> -readmethod=>'SearchIO');
>> my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
>>
>> my $v = 1;
>>
>> my $str = Bio::SeqIO->new(-file=>'ost3' , -format => 'fasta' );
>>
>> while (my $input = $str->next_seq()){
>> #Blast a sequence against a database:
>> #Alternatively, you could pass in a file with many
>> #sequences rather than loop through sequence one at a time
>> #Remove the loop starting 'while (my $input = $str->next_seq())'
>> #and swap the two lines below for an example of that.
>> my $r = $factory->submit_blast($input);
>> #my $r = $factory->submit_blast('amino.fa');
>> print STDERR "waiting..." if( $v > 0 );
>> while ( my @rids = $factory->each_rid ) {
>> foreach my $rid ( @rids ) {
>> my $rc = $factory->retrieve_blast($rid);
>> if( !ref($rc) ) {
>> if( $rc < 0 ) {
>> $factory->remove_rid($rid);
>> }
>> print STDERR "." if ( $v > 0 );
>> sleep 5;
>> } else {
>> my $result = $rc->next_result();
>> #save the output
>> my $filename = $result->query_name()."\.out";
>> $factory->save_output($filename);
>> $factory->remove_rid($rid);
>> print "\nQuery Name: ", $result->query_name(), "\n";
>> while ( my $hit = $result->next_hit ) {
>> next unless ( $v > 0);
>> print "\thit name is ", $hit->name, "\n";
>> while( my $hsp = $hit->next_hsp ) {
>> print "\t\tscore is ", $hsp->score, "\n";
>> }
>> }
>> }
>> }
>> }
>> }
>>
>>
>> Do you think there might still be something in the NCBI output
>> format?
>>
>> Thank you,
>> Guojun
>>
>>
>>
>>
>> Guojun Yang
>> Department of Plant Biology
>> University of Georgia
>> Tel: 706-542-1857
>> Fax: 706-542-1805
>> http://www.arches.uga.edu/~guojun
>>
>>
>>
>> ----- Original Message -----
>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>> To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
>> Subject: FW: [Bioperl-l] more on RemoteBlast.pm version 1.2
>>
>>
>>
>>> Sorry, forgot to add that I didn't see the regex issue that you
>>> mentioned.
>>> It could be a perl-related issue. Try the fixes I mentioned and
>>> see what
>>> happens.
>>>
>>>> Christopher Fields
>>>>
>>> Postdoctoral Researcher - Switzer Lab
>>> Dept. of Biochemistry
>>> University of Illinois Urbana-Champaign
>>>>>> -----Original Message-----
>>>>>>
>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>> Sent: Tuesday, February 14, 2006 12:36 PM
>>>> To: 'gyang at plantbio.uga.edu'
>>>> Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
>>>>
>>>>>> It's a good habit to always add single quotes around words.
>>>>>> The perl
>>>>>>
>>>> interpreter may think a single bare word is a subroutine or
>>>> perlfunc
>>>> called with no args so will try to find a subroutine named blastp
>>>> (). My
>>>> debugger actually gives the error that the bare word blastp may
>>>> conflict
>>>> with a future reserved word. Like you said, 'use strict' will
>>>> point that
>>>> out.
>>>>
>>>>>> As for the regex, it should match all the blast programs at
>>>>>> NCBI (blastp,
>>>>>>
>>>> blastn, blastx, tblastn, tblastx) and is built-in to make sure
>>>> nothing
>>>> else passes through.
>>>>
>>>>>> So, if you are using the script below, there are several
>>>>>> errors. The bare
>>>>>>
>>>> words for $prog and $db need quotes, and the flags for you
>>>> @params array
>>>> don't have a dash before them. I get this after adding quotes
>>>> but before
>>>> adding the dashes to @params:
>>>>
>>>>>> C:\Perl\Scripts>test_blast.pl
>>>>>> ------------- EXCEPTION: Bio::Root::Exception -------------
>>>>>>
>>>> MSG:
>>>> STACK: Error::throw
>>>> STACK: Bio::Root::Root::throw C:\Perl\src\bioperl\bioperl-
>>>> live/Bio/Root/Root.pm:328
>>>> STACK: Bio::Tools::Run::RemoteBlast::submit_parameter
>>>> C:\Perl\src\bioperl\bioperl-live/Bio/Tools/Run/RemoteBlast.pm:325
>>>> STACK: Bio::Tools::Run::RemoteBlast::new C:\Perl\src\bioperl
>>>> \bioperl-
>>>> live/Bio/Tools/Run/RemoteBlast.pm:256
>>>> STACK: C:\Perl\Scripts\test_blast.pl:15
>>>> -----------------------------------------------------------
>>>>
>>>>>> The last line indicates a problem with this line:
>>>>>> my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
>>>>>> Changing the @params to this:
>>>>>> my @params=( -prog=>$prog,
>>>>>>
>>>> -data=>$db,
>>>> -expect=>$e_val,
>>>> -readmethod=>'SearchIO');
>>>>
>>>>>> fixes it, and I get output as expected.
>>>>>> Christopher Fields
>>>>>>
>>>> Postdoctoral Researcher - Switzer Lab
>>>> Dept. of Biochemistry
>>>> University of Illinois Urbana-Champaign
>>>>
>>>>>>>>> -----Original Message-----
>>>>>>>>>
>>>>> From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
>>>>> Sent: Tuesday, February 14, 2006 11:48 AM
>>>>> To: Chris Fields; bioperl-l at lists.open-bio.org
>>>>> Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.2
>>>>>
>>>>> Hi, Chris,
>>>>> When I tried with the perldoc script, It did not work either.
>>>>> First it
>>>>> says $prog can not be bare word if I "use strict". I added
>>>>> quotes on the
>>>>> words, then it says the value for $prog does not match expression
>>>>> t?blast[pnx]. Rejecting. STACK ...RemoteBlast.pm 325 and 256. The
>>>>>
>>>> script
>>>>
>>>>> is shown below. Why is the expression "t?blast[pnx]"?
>>>>>
>>>>> #!/usr/bin/perl
>>>>>
>>>>> use Bio::SeqIO;
>>>>> use Bio::Seq;
>>>>> use Bio::Tools::Run::RemoteBlast;
>>>>> use Bio::SearchIO;
>>>>>
>>>>>
>>>>> my $prog=blastp;
>>>>> my $db=swissprot;
>>>>> my $e_val=1e-10;
>>>>> my @params=( prog=>$prog,
>>>>> data=>$db,
>>>>> expect=>$e_val,
>>>>> readmethod=>'SearchIO');
>>>>> my $factory=Bio::Tools::Run::RemoteBlast->new(@params);
>>>>>
>>>>> my $v = 1;
>>>>>
>>>>> my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format =>
>>>>> 'fasta' );
>>>>>
>>>>> while (my $input = $str->next_seq()){
>>>>> #Blast a sequence against a database:
>>>>> #Alternatively, you could pass in a file with many
>>>>> #sequences rather than loop through sequence one at a time
>>>>> #Remove the loop starting 'while (my $input = $str->next_seq())'
>>>>> #and swap the two lines below for an example of that.
>>>>> my $r = $factory->submit_blast($input);
>>>>> #my $r = $factory->submit_blast('amino.fa');
>>>>> print STDERR "waiting..." if( $v > 0 );
>>>>> while ( my @rids = $factory->each_rid ) {
>>>>> foreach my $rid ( @rids ) {
>>>>> my $rc = $factory->retrieve_blast($rid);
>>>>> if( !ref($rc) ) {
>>>>> if( $rc < 0 ) {
>>>>> $factory->remove_rid($rid);
>>>>> }
>>>>> print STDERR "." if ( $v > 0 );
>>>>> sleep 5;
>>>>> } else {
>>>>> my $result = $rc->next_result();
>>>>> #save the output
>>>>> my $filename = $result->query_name()."\.out";
>>>>> $factory->save_output($filename);
>>>>> $factory->remove_rid($rid);
>>>>> print "\nQuery Name: ", $result->query_name(), "\n";
>>>>> while ( my $hit = $result->next_hit ) {
>>>>> next unless ( $v > 0);
>>>>> print "\thit name is ", $hit->name, "\n";
>>>>> while( my $hsp = $hit->next_hsp ) {
>>>>> print "\t\tscore is ", $hsp->score, "\n";
>>>>> }
>>>>> }
>>>>> }
>>>>> }
>>>>> }
>>>>> }
>>>>>
>>>>> Thank you for your help!
>>>>>
>>>>>
>>>>> Guojun
>>>>> Department of Plant Biology
>>>>> University of Georgia
>>>>>
>>>>> ----- Original Message -----
>>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>> To: gyang at plantbio.uga.edu
>>>>> Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>
>>>>>
>>>>>
>>>>>> Try two things:
>>>>>>
>>>>>>> 1) Use a much simpler script, like the one in 'perldoc
>>>>>>>
>>>>>> Bio::Tools::Run::RemoteBlast'. If this fixes it, there's
>>>>>> something
>>>>>>
>>>>> wrong
>>>>>
>>>>>> with the logic in your subroutine:
>>>>>>
>>>>>>> my $v = 1;
>>>>>>> my $str = Bio::SeqIO->new(-file=>'amino.fa' , -format =>
>>>>>>> 'fasta' );
>>>>>>> while (my $input = $str->next_seq()){
>>>>>>>
>>>>>> #Blast a sequence against a database:
>>>>>> #Alternatively, you could pass in a file with many
>>>>>> #sequences rather than loop through sequence one at a time
>>>>>> #Remove the loop starting 'while (my $input = $str->next_seq())'
>>>>>> #and swap the two lines below for an example of that.
>>>>>> my $r = $factory->submit_blast($input);
>>>>>> #my $r = $factory->submit_blast('amino.fa');
>>>>>> print STDERR "waiting..." if( $v > 0 );
>>>>>> while ( my @rids = $factory->each_rid ) {
>>>>>> foreach my $rid ( @rids ) {
>>>>>> my $rc = $factory->retrieve_blast($rid);
>>>>>> if( !ref($rc) ) {
>>>>>> if( $rc < 0 ) {
>>>>>> $factory->remove_rid($rid);
>>>>>> }
>>>>>> print STDERR "." if ( $v > 0 );
>>>>>> sleep 5;
>>>>>> } else {
>>>>>> my $result = $rc->next_result();
>>>>>> #save the output
>>>>>> my $filename = $result->query_name()."\.out";
>>>>>> $factory->save_output($filename);
>>>>>> $factory->remove_rid($rid);
>>>>>> print "\nQuery Name: ", $result->query_name(), "\n";
>>>>>> while ( my $hit = $result->next_hit ) {
>>>>>> next unless ( $v > 0);
>>>>>> print "\thit name is ", $hit->name, "\n";
>>>>>> while( my $hsp = $hit->next_hsp ) {
>>>>>> print "\t\tscore is ", $hsp->score, "\n";
>>>>>> }
>>>>>> }
>>>>>> }
>>>>>> }
>>>>>> }
>>>>>> }
>>>>>>
>>>>>>> 2) Try the RemoteBlast from Bugzilla and see if that works. It
>>>>>>>
>>>> really
>>>>
>>>>>> shouldn't make that much of a difference, but I noticed that
>>>>>> the CVS
>>>>>> RemoteBlast (1.28) was changed in Dec 2005, after
>>>>>> bioperl-1.5.1 was
>>>>>> released; the Bugzilla version is based off CVS.
>>>>>>
>>>>>>> Christopher Fields
>>>>>>>
>>>>>> Postdoctoral Researcher - Switzer Lab
>>>>>> Dept. of Biochemistry
>>>>>> University of Illinois Urbana-Champaign
>>>>>>
>>>>>>>> -----Original Message-----
>>>>>>>>
>>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>>>>>>> bounces at lists.open-bio.org] On Behalf Of Guojun Yang
>>>>>>> Sent: Monday, February 13, 2006 3:00 PM
>>>>>>> To: bioperl-l at lists.open-bio.org
>>>>>>> Subject: Re: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>>>
>>>>>>>>> Thanks, Chris,
>>>>>>>>>
>>>>>>> I installed version 1.5.1 and replaced the blast.pm file with
>>>>>>> the
>>>>>>>
>>>> one
>>>>
>>>>> from
>>>>>
>>>>>>> your bug report. The running version is 1.5 when I use the
>>>>>>> command
>>>>>>>
>>>> you
>>>>
>>>>>>> sent me. But when I tried the script, it doesn't change much. My
>>>>>>> remoteblast code (portion) is here:
>>>>>>>
>>>>>>>>> sub search {
>>>>>>>>>
>>>>>>> local $Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'}
>>>>>>> ="$ORGN";
>>>>>>> local $Bio::Tools::Run::RemoteBlast::HEADER{'WORD_SIZE'}=7;
>>>>>>> local $Bio::Tools::Run::RemoteBlast::HEADER{'HITLIST_SIZE'}
>>>>>>> =5000;
>>>>>>> local
>>>>>>>
>>>>>>>
>>>> $Bio::Tools::Run::RemoteBlast::HEADER
>>>> {'COMPOSITION_BASED_STATISTICS'}=
>>>>
>>>>>>> 'no';
>>>>>>> local $Bio::Tools::Run::RemoteBlast::HEADER{'GAPCOSTS'}='3 1';
>>>>>>> my $query = Bio::Seq -> new ( -seq=>"$_[0]",
>>>>>>> -id=>"query",
>>>>>>> -desc=>"new seq");
>>>>>>> my $len=$query->length();
>>>>>>> @db=('nr','htgs','wgs');
>>>>>>> foreach my $db (@db) {
>>>>>>> my $factory = Bio::Tools::Run::RemoteBlast->new('-prog'
>>>>>>> =>'blastn',
>>>>>>> '-data' =>"$db",
>>>>>>>
>>>>>>>
>>> '-expect'=>"$E_value");
>>>
>>>>>>>>>>> my $blast_report = $factory->submit_blast($query);
>>>>>>>>>>>
>>>>>>>>> my @rids = $factory->each_rid();
>>>>>>>>>
>>>>>>> foreach my $rid ( @rids ) {
>>>>>>> print STDERR "$rid\n";
>>>>>>> }
>>>>>>> # RID = Remote Blast ID (e.g: 1017772174-16400-6638)
>>>>>>> print STDERR "waiting...";
>>>>>>> sleep 60;
>>>>>>>
>>>>>>>>> foreach my $rid ( @rids ) {
>>>>>>>>>
>>>>>>> my $rc = $factory->retrieve_blast($rid);
>>>>>>> while (!ref($rc) ) {
>>>>>>> if( $rc < 0 ) {
>>>>>>> # retrieve_blast returns -1 on error
>>>>>>> $factory->remove_rid($rid);
>>>>>>> print "Error!\n";
>>>>>>> send_error($email,$function,$seqname,$queryname[$ST]);
>>>>>>> die "Can't retrieve $rid";
>>>>>>> } if ($rc==0) { # retrieve_blast returns 0 on 'job not
>>>>>>>
>>>> finished'
>>>>
>>>>>>> sleep 60;
>>>>>>> $rc = $factory->retrieve_blast($rid);
>>>>>>> }
>>>>>>> }
>>>>>>> if (ref($rc)) {
>>>>>>> print STDERR "Done.\n";
>>>>>>> while( my $result = $rc->next_result) {
>>>>>>> while( my $hit = $result->next_hit()) {
>>>>>>> $hit_name=$hit->name;
>>>>>>> $hit_name =~ /\S+[|](\S+)[.]\d+[|].*/;
>>>>>>> $name=$1;
>>>>>>> @left_plus_start=();
>>>>>>> @left_plus_end=();
>>>>>>> @left_minus_start=();
>>>>>>> @left_minus_end=();
>>>>>>> @right_plus_start=();
>>>>>>> @right_plus_end=();
>>>>>>> @right_minus_start=();
>>>>>>> @right_minus_end=();
>>>>>>>
>>>>>>>>> if (!($name =~ /^[a-zA-Z][a-zA-Z]\_\d{6}/i)) {
>>>>>>>>>
>>>>>>> while( my $hsp = $hit->next_hsp()) {
>>>>>>> ......
>>>>>>>
>>>>>>>>> It was working quite well before around October laster
>>>>>>>>> year, but
>>>>>>>>>
>>>>> it has
>>>>>
>>>>>>> stopped since then, When a submission is sent via a webpage,
>>>>>>> the cgi
>>>>>>> starts to work and use a memory of ~20 Mb. Then it hangs there,
>>>>>>>
>>>>> finally
>>>>>
>>>>>>> the expected email is received but without real results
>>>>>>> although it
>>>>>>>
>>>>> does
>>>>>
>>>>>>> contain something from other parts of the script. Apparently the
>>>>>>>
>>>>> search
>>>>>
>>>>>>> sub did not return anything (I know there is something should be
>>>>>>> returned.). Is it also possible the format of the NCBI output
>>>>>>> for
>>>>>>>
>>>> each
>>>>
>>>>>>> result has changed?
>>>>>>> Thank you,
>>>>>>> Guojun
>>>>>>>
>>>>>>>>>>> Department of Plant Biology
>>>>>>>>>>>
>>>>>>> University of Georgia
>>>>>>>
>>>>>>>>>>>>> ----- Original Message -----
>>>>>>>>>>>>>
>>>>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>> To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
>>>>>>> Subject: RE: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>>>
>>>>>>>>>>>> How do you know two versions are installed (i.e. how are
>>>>>>>>>>>>
>>>> you
>>>>
>>>>> checking
>>>>>
>>>>>>> the
>>>>>>>
>>>>>>>> version)? Do you see have two complete bioperl
>>>>>>>> distributions (in
>>>>>>>>
>>>>> two
>>>>>
>>>>>>>> separate directories) or are you looking in modules? Here's
>>>>>>>> the
>>>>>>>>
>>>> way
>>>>
>>>>> to
>>>>>
>>>>>>>> check the version (from the FAQ):
>>>>>>>>
>>>>>>>>> perl -MBio::Root::Version -e 'print
>>>>>>>>>
>>>>> $Bio::Root::Version::VERSION,"\n"'
>>>>>
>>>>>>>>> If you have two full bioperl distributions on your computer,
>>>>>>>>>
>>>>> normally
>>>>>
>>>>>>> only
>>>>>>>
>>>>>>>> one will be in use unless you have explicitly set the
>>>>>>>> environment
>>>>>>>>
>>>>>>> variable
>>>>>>>
>>>>>>>> PERL5LIB. The PERL5LIB directories will be searched first
>>>>>>>> before
>>>>>>>>
>>>>> your
>>>>>
>>>>>>>> normal perl directory list (@INC) is searched. You MAY get
>>>>>>>> some
>>>>>>>>
>>>>> mixing
>>>>>
>>>>>>>> then, but only if perl can't find a particular module in the
>>>>>>>> path
>>>>>>>>
>>>>>>> designated
>>>>>>>
>>>>>>>> in PERL5LIB; then it will progress through the directories
>>>>>>>> listed
>>>>>>>>
>>>> in
>>>>
>>>>>>> @INC.
>>>>>>>
>>>>>>>> This may happen if a module is unique to a particular
>>>>>>>> release, but
>>>>>>>>
>>>>>>> shouldn't
>>>>>>>
>>>>>>>> happen for the majority of modules, including RemoteBlast. You
>>>>>>>>
>>>> can
>>>>
>>>>>>> check
>>>>>>>
>>>>>>>> what @INC and PERL5LIB are set to by using 'perl -V'. @INC
>>>>>>>> will
>>>>>>>>
>>>>> differ
>>>>>
>>>>>>>> depending on your OS, perl build, etc.
>>>>>>>>
>>>>>>>>> Regardless, if you follow the directions for installing
>>>>>>>>> bioperl
>>>>>>>>>
>>>>> for
>>>>>
>>>>>>> your
>>>>>>>
>>>>>>>> system ('perl Makefile.PL', 'make', 'make test', 'make
>>>>>>>> install',
>>>>>>>>
>>>>> unless
>>>>>
>>>>>>> you
>>>>>>>
>>>>>>>> explicitly change the installation directory when using 'perl
>>>>>>>>
>>>>>>> Makefile.PL'),
>>>>>>>
>>>>>>>> then 'uninstalling' Bioperl shouldn't be a problem as it will
>>>>>>>>
>>>>> install
>>>>>
>>>>>>> the
>>>>>>>
>>>>>>>> Bioperl distribution you downloaded over the old version in
>>>>>>>> @INC.
>>>>>>>>
>>>>> See
>>>>>
>>>>>>> this
>>>>>>>
>>>>>>>> page:
>>>>>>>>
>>>>>>>>> http://bioperl.open-bio.org/SRC/bioperl-live/INSTALL
>>>>>>>>> for more details.
>>>>>>>>> Christopher Fields
>>>>>>>>>
>>>>>>>> Postdoctoral Researcher - Switzer Lab
>>>>>>>> Dept. of Biochemistry
>>>>>>>> University of Illinois Urbana-Champaign
>>>>>>>>
>>>>>>>>>>> -----Original Message-----
>>>>>>>>>>>
>>>>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>>>>>>>>> bounces at lists.open-bio.org] On Behalf Of Guojun Yang
>>>>>>>>> Sent: Monday, February 13, 2006 12:32 PM
>>>>>>>>> To: bioperl-l at lists.open-bio.org
>>>>>>>>> Subject: [Bioperl-l] more on RemoteBlast.pm version 1.28
>>>>>>>>>
>>>>>>>>>>> Hi, Chris,
>>>>>>>>>>>
>>>>>>>>> I do have different versions of bioperl on my Linux machine
>>>>>>>>>
>>>> (1.4.
>>>>
>>>>> and
>>>>>
>>>>>>>>> 1.5.0), this may be the problem. Should I just install
>>>>>>>>> bioperl-
>>>>>>>>>
>>>>> 1.5.1
>>>>>
>>>>>>> or I
>>>>>>>
>>>>>>>>> need to uninstall and remove the previous versions. I could
>>>>>>>>> not
>>>>>>>>>
>>>>> find
>>>>>
>>>>>>> any
>>>>>>>
>>>>>>>>> hint on uninstalling bioperl on linux. Could you please
>>>>>>>>> give me
>>>>>>>>>
>>>>> some
>>>>>
>>>>>>>>> suggestion?
>>>>>>>>> Thanks,
>>>>>>>>> Guojun
>>>>>>>>>
>>>>>>>>>>> Department of Plant Biology
>>>>>>>>>>>
>>>>>>>>> University of Georgia
>>>>>>>>> _____
>>>>>>>>>
>>>>>>>>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>>>>>>
>>>>>>>>> To: gyang at plantbio.uga.edu, bioperl-l at lists.open-bio.org
>>>>>>>>> Sent: Mon, 13 Feb 2006 11:45:14 -0500
>>>>>>>>> Subject: RE: [Bioperl-l] more question regarding
>>>>>>>>> RemoteBlast.pm
>>>>>>>>>
>>>>>>> version
>>>>>>>
>>>>>>>>> 1.28
>>>>>>>>>
>>>>>>>>>>>>>>> If you're using RemoteBlast 1.28, then you've likely
>>>>>>>>>>>>>>>
>>>>>>> updated from CVS
>>>>>>>
>>>>>>>>> which isn't the latest fix.
>>>>>>>>>
>>>>>>>>>>> Make sure that you check the following:
>>>>>>>>>>> 1) Always post to the mailing list:
>>>>>>>>>>>
>>>>>>>>> http://www.bioperl.org/wiki/
>>>>>>>>> HOWTO:Beginners#Getting_Assistance .
>>>>>>>>>
>>>>>>>>>>> 2) You must have the complete bioperl-1.5.1 or bioperl-live
>>>>>>>>>>>
>>>>> (CVS)
>>>>>
>>>>>>>>> installed first. Perform a clean installation; do not upgrade
>>>>>>>>>
>>>>> only
>>>>>
>>>>>>>>> Bio::SearchIO::blast and Bio::Tools::Run::RemoteBlast, as we
>>>>>>>>>
>>>> can't
>>>>
>>>>>>>>> guarantee that mixing modules from old and new distributions
>>>>>>>>>
>>>> (1.4
>>>>
>>>>> and
>>>>>
>>>>>>>>> 1.5.1, for instance) will work. A bioperl-1.5.1 or bioperl-
>>>>>>>>> live
>>>>>>>>> installation will allow text output from BLAST v.2.2.12 to be
>>>>>>>>>
>>>>> saved
>>>>>
>>>>>>> and
>>>>>>>
>>>>>>>>> parsed; it will not parse the newest BLAST text output from
>>>>>>>>> NCBI
>>>>>>>>>
>>>>>>> (v2.2.13)
>>>>>>>
>>>>>>>>> but it should still save it. I believe as long as
>>>>>>>>> next_results()
>>>>>>>>>
>>>>> isn't
>>>>>
>>>>>>>>> called, it will work.
>>>>>>>>>
>>>>>>>>>>> 3) The bug fixes for the above issue with parsing BLAST
>>>>>>>>>>>
>>>> 2.2.13
>>>>
>>>>>>> text output
>>>>>>>
>>>>>>>>> are NOT in CVS; they haven't been cleared and checked in by
>>>>>>>>>
>>>> Roger
>>>>
>>>>> Hall
>>>>>
>>>>>>>>> (who's now taking care of RemoteBlast) and the powers that be
>>>>>>>>>
>>>>> (Jason
>>>>>
>>>>>>> or
>>>>>>>
>>>>>>>>> whomever is in charge of Bio::SearchIO). They can be found in
>>>>>>>>>
>>>>>>> Bugzilla:
>>>>>>>
>>>>>>>>>>> http://bugzilla.bioperl.org/show_bug.cgi?id=1934
>>>>>>>>>>>
>>>>>>>>> http://bugzilla.bioperl.org/show_bug.cgi?id=1935
>>>>>>>>>
>>>>>>>>>>> The fix in RemoteBlast in Bugzilla (#1935) is to allow the
>>>>>>>>>>>
>>>>> option
>>>>>
>>>>>>> of
>>>>>>>
>>>>>>>>> saving XML output, so isn't necessary if you don't plan on
>>>>>>>>> using
>>>>>>>>>
>>>>> this
>>>>>
>>>>>>>>> option. And, remember, they haven't been committed yet to
>>>>>>>>> CVS,
>>>>>>>>>
>>>>> which
>>>>>
>>>>>>>>> means that the final version will change to refle the new
>>>>>>>>>
>>>> version.
>>>>
>>>>>>>>>>>>> Christopher Fields
>>>>>>>>>>>>>
>>>>>>>>> Postdoctoral Researcher - Switzer Lab
>>>>>>>>> Dept. of Biochemistry
>>>>>>>>> University of Illinois Urbana-Champaign
>>>>>>>>>
>>>>>>>>>>>>> _____
>>>>>>>>>>>>> From: Guojun Yang [mailto:gyang at plantbio.uga.edu]
>>>>>>>>>>>>>
>>>>>>>>> Sent: Monday, February 13, 2006 9:26 AM
>>>>>>>>> To: Chris Fields
>>>>>>>>> Subject: RE: [Bioperl-l] more question regarding
>>>>>>>>> RemoteBlast.pm
>>>>>>>>>
>>>>>>> version
>>>>>>>
>>>>>>>>> 1.28
>>>>>>>>>
>>>>>>>>>>>>> Hi, Chris
>>>>>>>>>>>>>
>>>>>>>>>>> Thanks for your suggestion, however, it doesn't seem to work
>>>>>>>>>>>
>>>>> for
>>>>>
>>>>>>> my cgi
>>>>>>>
>>>>>>>>> even after I replace both blast.pm and RemoteBlast.pm. I
>>>>>>>>> didn't
>>>>>>>>>
>>>>> even
>>>>>
>>>>>>> get
>>>>>>>
>>>>>>>>> any RID. Is there any suggestion?
>>>>>>>>>
>>>>>>>>>>>>>>> Guojun
>>>>>>>>>>>>>>>
>>>>>>>>>>>>> Guojun Yang
>>>>>>>>>>>>>
>>>>>>>>> Department of Plant Biology
>>>>>>>>> University of Georgia
>>>>>>>>> Tel: 706-542-1857
>>>>>>>>> Fax: 706-542-1805
>>>>>>>>> http://www.arches.uga.edu/~guojun
>>>>>>>>> _____
>>>>>>>>>
>>>>>>>>>>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>>>>>>>>
>>>>>>>>> To: gyang at plantbio.uga.edu, bioperl-l at bioperl.org
>>>>>>>>> Sent: Fri, 03 Feb 2006 16:07:29 -0500
>>>>>>>>> Subject: RE: [Bioperl-l] more question regarding
>>>>>>>>> RemoteBlast.pm
>>>>>>>>>
>>>>>>> version
>>>>>>>
>>>>>>>>> 1.28
>>>>>>>>>
>>>>>>>>>>> I would say give the new code a try, but realize that it
>>>>>>>>>>>
>>>>> hasn't
>>>>>
>>>>>>> been
>>>>>>>
>>>>>>>>> checked
>>>>>>>>> in (like I said below). I will try going over the modified
>>>>>>>>> Bio::SearchIO::blast again this weekend to see if there is
>>>>>>>>>
>>>>> anything I
>>>>>
>>>>>>>>> might
>>>>>>>>> have missed. The changed order in the header of BLAST text
>>>>>>>>>
>>>> output
>>>>
>>>>> has
>>>>>
>>>>>>> me a
>>>>>>>
>>>>>>>>> bit worried that it might not catch everything, but it at
>>>>>>>>> least
>>>>>>>>>
>>>>>>> doesn't
>>>>>>>
>>>>>>>>> hang
>>>>>>>>> in the while() loop I described in the bug report below (bug
>>>>>>>>>
>>>>> #1934)
>>>>>
>>>>>>> and
>>>>>>>
>>>>>>>>> seems to process everything fine.
>>>>>>>>>
>>>>>>>>>>> If you want more stability in the code, you might consider
>>>>>>>>>>>
>>>>>>> changing over
>>>>>>>
>>>>>>>>> to
>>>>>>>>> XML output and parsing with Bio::SearchIO::blastxml. There are
>>>>>>>>>
>>>>> some
>>>>>
>>>>>>>>> changes
>>>>>>>>> in Bio::Tools::Run::RemoteBlast (bug #1935) that accommodate
>>>>>>>>>
>>>>> saving
>>>>>
>>>>>>> XML
>>>>>>>
>>>>>>>>> output, but I believe it parses everything regardless. If you
>>>>>>>>>
>>>> look
>>>>
>>>>>>> back
>>>>>>>
>>>>>>>>> the
>>>>>>>>> last month or so there has been a bit of discussion here about
>>>>>>>>>
>>>> it.
>>>>
>>>>>>> Jason
>>>>>>>
>>>>>>>>> describes a bit on how to set up RemoteBlast for XML:
>>>>>>>>>
>>>>>>>>>>> http://bioperl.org/news/2005/11/06/getting-blastxml-using-
>>>>>>>>>>>
>>>>>>> remoteblast/
>>>>>>>
>>>>>>>>>>> Christopher Fields
>>>>>>>>>>>
>>>>>>>>> Postdoctoral Researcher - Switzer Lab
>>>>>>>>> Dept. of Biochemistry
>>>>>>>>> University of Illinois Urbana-Champaign
>>>>>>>>>
>>>>>>>>>>>> -----Original Message-----
>>>>>>>>>>>>
>>>>>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l-
>>>>>>>>>> bounces at lists.open-bio.org] On Behalf Of Guojun Yang
>>>>>>>>>> Sent: Friday, February 03, 2006 1:45 PM
>>>>>>>>>> To: bioperl-l at bioperl.org
>>>>>>>>>> Subject: [Bioperl-l] more question regarding RemoteBlast.pm
>>>>>>>>>>
>>>>> version
>>>>>
>>>>>>> 1.28
>>>>>>>
>>>>>>>>>> Hi, Everybody,
>>>>>>>>>> I see this post and am wondering if this is the reason for
>>>>>>>>>> the
>>>>>>>>>> malfunctionning of my webserver. We set up a webserver named
>>>>>>>>>>
>>>>> MAK,
>>>>>
>>>>>>> for
>>>>>>>
>>>>>>>>> MITE
>>>>>>>>>
>>>>>>>>>> sequence analysis. It was working very well until around
>>>>>>>>>>
>>>>> November
>>>>>
>>>>>>> 2005,
>>>>>>>
>>>>>>>>>> when it stopped returning any result (the site is fine and
>>>>>>>>>>
>>>> seems
>>>>
>>>>> to
>>>>>
>>>>>>> be
>>>>>>>
>>>>>>>>>> doing sth after submission). In the CGI script, I used
>>>>>>>>>>
>>>>> remoteblast
>>>>>
>>>>>>> (that
>>>>>>>
>>>>>>>>>> work was done in 2003) to do searches. I currently do not
>>>>>>>>>> have
>>>>>>>>>>
>>>>>>> access to
>>>>>>>
>>>>>>>>>> the server because I moved. Quite several people sent emails
>>>>>>>>>>
>>>> to
>>>>
>>>>> us
>>>>>
>>>>>>> about
>>>>>>>
>>>>>>>>>> its malfunctioning. Is there any suggestion on fixing the
>>>>>>>>>>
>>>>> problem?
>>>>>
>>>>>>>>> Should
>>>>>>>>>
>>>>>>>>>> I simplily ask the remoteblast.pm be replaced with the new
>>>>>>>>>>
>>>>> version?
>>>>>
>>>>>>>>>> Thanks a lot,
>>>>>>>>>> Guojun
>>>>>>>>>>
>>>>>>>>>> Department of Plant Biology
>>>>>>>>>> University of Georgia
>>>>>>>>>> Tel: 706-542-1857
>>>>>>>>>> Fax: 706-542-1805
>>>>>>>>>> http://www.arches.uga.edu/~guojun
>>>>>>>>>> _____
>>>>>>>>>>
>>>>>>>>>> From: Chris Fields [mailto:cjfields at uiuc.edu]
>>>>>>>>>> To: 'Nagesh Chakka' [mailto:nagesh.chakka at anu.edu.au], 'Huang
>>>>>>>>>>
>>>>> Jian'
>>>>>
>>>>>>>>>> [mailto:hjian at kuicr.kyoto-u.ac.jp], 'bioperl-l'
>>>>>>>>>>
>>>> [mailto:bioperl-
>>>>
>>>>>>>>>> l at bioperl.org]
>>>>>>>>>> Sent: Fri, 03 Feb 2006 10:45:23 -0500
>>>>>>>>>> Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
>>>>>>>>>>
>>>>>>>>>> Like Nagesh says, try the latest RemoteBlast from bioperl-
>>>>>>>>>> live
>>>>>>>>>>
>>>>> CVS.
>>>>>
>>>>>>> It
>>>>>>>
>>>>>>>>>> will
>>>>>>>>>> work for saving text output. However, it will not parse
>>>>>>>>>>
>>>> anything
>>>>
>>>>>>> using
>>>>>>>
>>>>>>>>>> next_result (it will likely hang) and will not save XML
>>>>>>>>>>
>>>> format.
>>>>
>>>>> See
>>>>>
>>>>>>>>> these
>>>>>>>>>
>>>>>>>>>> bugs:
>>>>>>>>>>
>>>>>>>>>> http://bugzilla.bioperl.org/show_bug.cgi?id=1934
>>>>>>>>>> http://bugzilla.bioperl.org/show_bug.cgi?id=1935
>>>>>>>>>>
>>>>>>>>>> for explanations and possible fixes (changes to RemoteBlast
>>>>>>>>>>
>>>> and
>>>>
>>>>>>>>>> Bio::SearchIO::blast). Note that these haven't been
>>>>>>>>>> checked in
>>>>>>>>>>
>>>>> yet
>>>>>
>>>>>>> so
>>>>>>>
>>>>>>>>> are
>>>>>>>>>
>>>>>>>>>> still not included in bioperl-live; they may be further
>>>>>>>>>>
>>>> modified
>>>>
>>>>>>> before
>>>>>>>
>>>>>>>>>> committing to CVS. If you're not worried about XML, you could
>>>>>>>>>>
>>>>> just
>>>>>
>>>>>>> try
>>>>>>>
>>>>>>>>> the
>>>>>>>>>
>>>>>>>>>> first fix, which is a change to SearchIO::blast.
>>>>>>>>>>
>>>>>>>>>> Nagesh, I remember you posting to the list a month ago
>>>>>>>>>> using a
>>>>>>>>>>
>>>>>>> script
>>>>>>>
>>>>>>>>>> which
>>>>>>>>>> had problems; the script you used saves the output but
>>>>>>>>>> doesn't
>>>>>>>>>>
>>>>>>> actually
>>>>>>>
>>>>>>>>>> parse it (i.e. you don't use next_result() to go through the
>>>>>>>>>>
>>>>> data).
>>>>>
>>>>>>> Is
>>>>>>>
>>>>>>>>> the
>>>>>>>>>
>>>>>>>>>> version of BLAST in your text output 2.2.12 or 2.2.13? Have
>>>>>>>>>>
>>>> you
>>>>
>>>>>>> tried
>>>>>>>
>>>>>>>>>> parsing the output using "-readmethod => SearchIO" or "-
>>>>>>>>>>
>>>>> readmethod
>>>>>
>>>>>>> =>
>>>>>>>
>>>>>>>>>> blast"
>>>>>>>>>> using your version of RemoteBlast and method next_result()?
>>>>>>>>>>
>>>> Like
>>>>
>>>>>>> below
>>>>>>>
>>>>>>>>>> (from
>>>>>>>>>> perldoc):
>>>>>>>>>>
>>>>>>>>>> while ( my @rids = $factory->each_rid ) {
>>>>>>>>>> foreach my $rid ( @rids ) {
>>>>>>>>>> my $rc = $factory->retrieve_blast($rid);
>>>>>>>>>> if( !ref($rc) ) {
>>>>>>>>>> if( $rc < 0 ) {
>>>>>>>>>> $factory->remove_rid($rid);
>>>>>>>>>> }
>>>>>>>>>> print STDERR "." if ( $v > 0 );
>>>>>>>>>> sleep 5;
>>>>>>>>>> } else { # parsing
>>>>>>>>>> starts here
>>>>>>>>>> my $result = $rc->next_result(); # it should hang
>>>>>>>>>> here
>>>>>>>>>> #save the output
>>>>>>>>>> my $filename = $result->query_name()."\.out";
>>>>>>>>>> $factory->save_output($filename);
>>>>>>>>>> $factory->remove_rid($rid);
>>>>>>>>>> print "\nQuery Name: ", $result->query_name(), "\n";
>>>>>>>>>> while ( my $hit = $result->next_hit ) {
>>>>>>>>>> next unless ( $v > 0);
>>>>>>>>>> print "\thit name is ", $hit->name, "\n";
>>>>>>>>>> while( my $hsp = $hit->next_hsp ) {
>>>>>>>>>> print "\t\tscore is ", $hsp->score, "\n";
>>>>>>>>>> }
>>>>>>>>>> }
>>>>>>>>>> }
>>>>>>>>>> }
>>>>>>>>>> }
>>>>>>>>>> }
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> My script hanged if I used next_result() in any way prior to
>>>>>>>>>>
>>>> the
>>>>
>>>>>>> fixes.
>>>>>>>
>>>>>>>>> I
>>>>>>>>>
>>>>>>>>>> want to see how many others are having the same issues with
>>>>>>>>>>
>>>>> parsing
>>>>>
>>>>>>>>> using
>>>>>>>>>
>>>>>>>>>> the CVS version of bioperl-live.
>>>>>>>>>>
>>>>>>>>>> Christopher Fields
>>>>>>>>>> Postdoctoral Researcher - Switzer Lab
>>>>>>>>>> Dept. of Biochemistry
>>>>>>>>>> University of Illinois Urbana-Champaign
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>> -----Original Message-----
>>>>>>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-
>>>>>>>>>>>
>>>> l-
>>>>
>>>>>>>>>>> bounces at lists.open-bio.org] On Behalf Of Nagesh Chakka
>>>>>>>>>>> Sent: Thursday, February 02, 2006 7:24 PM
>>>>>>>>>>> To: Huang Jian; bioperl-l
>>>>>>>>>>> Subject: Re: [Bioperl-l] RemoteBlast.pm version 1.28
>>>>>>>>>>>
>>>>>>>>>>> Hi Huang,
>>>>>>>>>>> Thanks for the message. The older version of RemoteBlast.pm
>>>>>>>>>>>
>>>>> works
>>>>>
>>>>>>> on
>>>>>>>
>>>>>>>>> the
>>>>>>>>>
>>>>>>>>>>> logic of checking the temporary file size to determine
>>>>>>>>>>>
>>>> whether
>>>>
>>>>> the
>>>>>
>>>>>>>>> Blast
>>>>>>>>>
>>>>>>>>>>> results are ready. This condition is not getting satisfied
>>>>>>>>>>>
>>>> may
>>>>
>>>>> be
>>>>>
>>>>>>> due
>>>>>>>
>>>>>>>>> to
>>>>>>>>>
>>>>>>>>>>> some changes brought about by NCBI. I had this problem
>>>>>>>>>>>
>>>>> recently
>>>>>
>>>>>>> and
>>>>>>>
>>>>>>>>>>> figured out that the solution was to use the latest version
>>>>>>>>>>>
>>>>> which
>>>>>
>>>>>>> has
>>>>>>>
>>>>>>>>>>> this problem fixed (does not use file size logic any more)
>>>>>>>>>>>
>>>>> which
>>>>>
>>>>>>> is
>>>>>>>
>>>>>>>>> not
>>>>>>>>>
>>>>>>>>>>> yet included in the BioPerl package.
>>>>>>>>>>> Cheers
>>>>>>>>>>> Nagesh
>>>>>>>>>>>
>>>>>>>>>>> Huang Jian wrote:
>>>>>>>>>>>
>>>>>>>>>>>
>>>>>>>>>>>> Dear Nagesh,
>>>>>>>>>>>>
>>>>>>>>>>>> I have replaced my old RemoteBlast.pm (v 1.17) with v 1.28
>>>>>>>>>>>>
>>>>> you
>>>>>
>>>>>>> send
>>>>>>>
>>>>>>>>>>>> me. Now it works perfectly!!!
>>>>>>>>>>>>
>>>>>>>>>>>> Thank you!!
>>>>>>>>>>>>
>>>>>>>>>>>> Huang
>>>>>>>>>>>>
>>>>>>>>>>>> ----- Original Message ----- From: "Nagesh Chakka"
>>>>>>>>>>>> <nagesh.chakka at anu.edu.au>
>>>>>>>>>>>> To: "Huang Jian" <hjian at kuicr.kyoto-u.ac.jp>; "bioperl-l"
>>>>>>>>>>>> <bioperl-l at bioperl.org>
>>>>>>>>>>>> Sent: Friday, February 03, 2006 7:48 AM
>>>>>>>>>>>> Subject: Re: [Bioperl-l] Sorry, failure in post on the
>>>>>>>>>>>>
>>>> net,
>>>>
>>>>> so
>>>>>
>>>>>>> still
>>>>>>>
>>>>>>>>>>>> via email
>>>>>>>>>>>>
>>>>>>>>>>>>
>>>>>>>>>>>>
>>>>>>>>>>>>> Hi Huang,
>>>>>>>>>>>>> I see that you are submitting a sequence for a remote
>>>>>>>>>>>>>
>>>> blast
>>>>
>>>>>>> search.
>>>>>>>
>>>>>>>>>> Can
>>>>>>>>>>
>>>>>>>>>>>>> you check if the RemoteBlast.pm being used is v 1.28
>>>>>>>>>>>>>
>>>>>>> (2005/12/09).
>>>>>>>
>>>>>>>>> If
>>>>>>>>>
>>>>>>>>>>>>> not I have attached it with this email, try to replace it
>>>>>>>>>>>>>
>>>>> with
>>>>>
>>>>>>> the
>>>>>>>
>>>>>>>>>> old
>>>>>>>>>>
>>>>>>>>>>>>> one which has a bug.
>>>>>>>>>>>>> Let me know if it works.
>>>>>>>>>>>>> Nagesh
>>>>>>>>>>>>>
>>>>>>>>>>>>
>>>>>>>>>>> _______________________________________________
>>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>>
>>>>>>>>>> _______________________________________________
>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>>
>>>>>>>>>> _______________________________________________
>>>>>>>>>> Bioperl-l mailing list
>>>>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>>
>>>>>>> _______________________________________________
>>>>>>>
>>>>>>>>> Bioperl-l mailing list
>>>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>>>
>>>>>>>>> _______________________________________________
>>>>>>>>>
>>>>>>> Bioperl-l mailing list
>>>>>>> Bioperl-l at lists.open-bio.org
>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>>>>>>
>>>>>>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> Bioperl-l at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>>
>
> Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm
>
Christopher Fields
Postdoctoral Researcher
Lab of Dr. Robert Switzer
Dept of Biochemistry
University of Illinois Urbana-Champaign
More information about the Bioperl-l
mailing list