[Bioperl-l] What format is this? Supported with BioSeq::IO?
Andreas Kahari
ak at ebi.ac.uk
Mon Feb 14 10:06:07 EST 2005
Without knowing anything about the particular format
or data involved, seaching the web for "sequence" and
"EEEEEEEEEEEEEEEEEEEEEEE" (various lengths) with google gives a
couple of hints leading to something called HSSP (a database of
protein structure-sequence alignments).
http://www.google.co.uk/search?q=HSSP+protein+structure-sequence+alignments
More examples:
http://www.cbi.pku.edu.cn/Docbak/homo-model-course/1crnHSSP.html
http://www.sciences.fundp.ac.be/biologie/bms/input.html#hssp
I don't think there is a BioPerl parser for it.
Andreas
On Mon, Feb 14, 2005 at 09:35:33AM +0800, Edward WIJAYA wrote:
> Hi,
>
> I am new to BioPerl.
> I would like to know what format is this file (also attached)?
>
> ___BEGIN__
> 299 MMMTCP1G.1 CAT Z35294 Eukaryotae; mitochondrial eukaryotes; Metazoa;
> Chordata; Vertebrata; Eutheria; Rodentia; Sciurognathi; Myomorpha;
> Muridae; Murinae; Mus. Mus musculus
> CCTCGGCTCGGGATGCCCCTTGGTTCGTCCTAGGCTCA
> ............iMMMMMMMMMMMMMMMMMMMMMMMMM
> __END__
>
> Is it supported with BioSeq::IO?
>
> Basically what I am trying to do is to write a
> Transcription Initiation StartSite recognition program with Perl
> given the file.
>
> Thanks and hope to hear from you again.
--
Andreas Kähäri
EMBL-EBI/ensembl
1024D/C2E163CB
More information about the Bioperl-l
mailing list