[Bioperl-l] RemoteBlast: No Significant Matches (works for web interface)

[Jason Stajich]

You might want to post exactly the script you have run, embedding the  
sequence data in it so someone else might be able to help with the  
minimal amount of playing around.

-jason
On Nov 9, 2004, at 12:37 PM, Affan Qureshi wrote:

> I have tried blastn as well as blastx searches but they dont give me  
> any
> result. Also nt database doesnt help either. There must be something
> wrong with the code I think.
>
> In fact the following sequence gives an error: Protein FASTA provided
> for Nucleotide sequence. The other sequence doesnt give me this error
> but no results either.
>
> This is my sequence which gives me the above error:
>
> AGGTCAAGGCAAAGGGCCACAAAGCCATTGGATCAACGAGCTACACCGTCGACATGTTCGTTGAGAACACG 
> AACTTCTTC
> GTCCAGGTCACAAGCGCCCGATCGGTTCCTGCCACCTTGAAGGCCATCAGCCTGAATTCACTGGAGCTCAA 
> GATACGCGA
> AAGTACCAAGCTCGGCCTGAACAAGGCACGCAGTAAGAAGTACCACGAGGCGATCCGGACCCGCGTCCAGG 
> ACCAACTGG
> CGGCCCTACTGTACGGAAGTTTCCGAGACGCGCTGAACAATTCCCTTGCTACCGTAACTGCGCCATTCCCC 
> TGATTTACA
> GTTATGCGAAAAATACGCCCCACGACTTGCAAATTTGCCTCTTCAGAGTCACTGTACAGGTTCCAAAAGAT 
> TGTGGATTA
> AGCATGGAATAACGTGTATAGAACCTTGAAATAAACTGGTGGGGAAATACAAAAAAAAAAAAAAAAAAAA
>
> Also this one with no error but no results either:
> GGGGTGGCATGGCATTAGGCCGGGGATCCTGCAAAGTGAAGAATATTTCCTGGTCTATCCCCTTTCACNAA 
> AGTATTTGC
> CTGGGCAATCCAACAGGGTGTGTCCAAGGCTGTCTCNCATGGTGTGGGGGCCCTAATTAACAAGGGATAAA 
> TCAGCAGTA
> TTTCCNTCCAACACTGGNACNCNAATAAAGTATGTGNNCCCCACGAAAAAAAAAAAAAAAAAAAA
>
> Here is the tail of some output on the screen when running the first
> sequence which probably shows the parameters passed to Blast:
>
> ........NATGGCATTAGGCCGGGGGACGCTTCGAGNTANCCGCATCGCCGANTTCCGCAANTCAGTTGT 
> GNGCTAC
> TTCCA%00A02_DVMGL_P1DVM-contig_58%00&WORD+SIZE=11&EXPECT=1e 
> -10&SERVICE=plain&
> FORMAT_OBJECT=Alignment&CMD=Put&CDD_SEARCH=off&PROGRAM=blastn
>
> Thanks for your time,
>
> Affan
>
>> nt is usually used for nucleotide BLAST ... that came across backwards
>> :)
>>
>> JO
>>
>>
>> On Sun, 7 Nov 2004 22:41:02 -0600, Joshua Orvis <jorvis at gmail.com>
>> wrote:
>>> I get different things with it when I use nr as the database rather
>>> than nt when doing nucleotide BLAST.  Try that.  What's your sequence
>>> (just in case)?
>>>
>>> JO
>>>
>>>
>>>
>>>
>>> On Sun, 7 Nov 2004 21:58:43 -0500 (EST), affan qureshi
>>> <aqureshi at cs.odu.edu> wrote:
>>>> Hi,
>>>> I am trying to use the Remote Blast example for my own Nucleotide
>>> sequence but I get No Significant Matches found response from the
>>> server. However the same query gives me matches for the web-based
>>> interface
>>>> "Nucleotide-nucleotide BLAST (blastn)" on the NCBI website.
>>>>
>>>> Do you know what I could be doing wrong? I searched the archive but
>>> saw a similar question for which i couldnt find the answer. Also is
>>> there a way to see the actual parameters being passed to the server
>>> and compare them with the web-based ones?
>>>>
>>>> Thanks a lot,
>>>>
>>>> Affan
>>>>
>>>> Here is my code:
>>>>
>>>> sub doBlast {
>>>>         #this is the filename containing nucleotide sequence
>>>>         my($filename) = @_;
>>>>
>>>>         my $prog = 'blastn';
>>>>         my $db   = 'nr';
>>>>         my $e_val= '1e-10';
>>>>
>>>>         my @params = ( '-prog' => $prog,
>>>>                         '-data' => $db,
>>>>                         '-expect' => $e_val,
>>>>                         '-readmethod' => 'SearchIO' );
>>>>
>>>>         my $factory = Bio::Tools::Run::RemoteBlast->new(@params);
>>>>
>>>>         #change a paramter
>>>>         #$Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'} =
>>> 'Homo sapiens
>>>> [ORGN]';
>>>>
>>>>         #remove a parameter
>>>>         #delete $Bio::Tools::Run::RemoteBlast::HEADER{'FILTER'};
>>>>
>>>>         my $v = 1;
>>>>         #$v is just to turn on and off the messages
>>>>
>>>>         my $seqio = Bio::SeqIO->new(-file=>$filename, '-format' =>
>>> 'fasta' );
>>>>
>>>>         while (my $input = $seqio->next_seq()) {
>>>>
>>>>                 #Blast a sequence against a database:
>>>>
>>>>                 my $r = $factory->submit_blast($input);
>>>>
>>>>                 print STDERR "waiting..." if( $v > 0 );
>>>>                 while ( my @rids = $factory->each_rid ) {
>>>>                 foreach my $rid ( @rids ) {
>>>>                         my $rc = $factory->retrieve_blast($rid);
>>> if(
>>> !ref($rc) ) {
>>>>                                 if( $rc < 0 ) {
>>>>                                         $factory->remove_rid($rid);
>>>>                                 }
>>>>                                 print STDERR "." if ( $v > 0 );
>>> sleep 5;
>>>>                         } else {
>>>>                                 my $result = $rc->next_result();
>>> #save the output
>>>>                                 my $filename =
>>> 'results/'.$result->query_name().".blast";
>>> $factory->save_output($filename);
>>> $factory->remove_rid($rid);
>>>>                                 print "\nQuery Name: ",
>>> $result->query_name(), "\n"; while (
>>> my $hit = $result->next_hit ) {
>>>>                                         next unless ( $v > 0);
>>> print
>>> "\thit name is ",
>>> $hit->name, "\n"; while( my
>>> $hsp = $hit->next_hsp ) {
>>> print "\t\tscore is ",
>>> $hsp->score, "\n"; }
>>>>                                 }
>>>>                         }
>>>>                 }
>>>>                 }
>>>>         }
>>>>
>>>> }
>>>>
>>>> _______________________________________________
>>>> Bioperl-l mailing list
>>>> Bioperl-l at portal.open-bio.org
>>>> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>>>>
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/