[Bioperl-l] RemoteBlast: No Significant Matches (works for web interface)

Affan Qureshi aqureshi at cs.odu.edu
Tue Nov 9 12:37:03 EST 2004


I have tried blastn as well as blastx searches but they dont give me any
result. Also nt database doesnt help either. There must be something
wrong with the code I think.

In fact the following sequence gives an error: Protein FASTA provided
for Nucleotide sequence. The other sequence doesnt give me this error
but no results either.

This is my sequence which gives me the above error:

AGGTCAAGGCAAAGGGCCACAAAGCCATTGGATCAACGAGCTACACCGTCGACATGTTCGTTGAGAACACGAACTTCTTC
GTCCAGGTCACAAGCGCCCGATCGGTTCCTGCCACCTTGAAGGCCATCAGCCTGAATTCACTGGAGCTCAAGATACGCGA
AAGTACCAAGCTCGGCCTGAACAAGGCACGCAGTAAGAAGTACCACGAGGCGATCCGGACCCGCGTCCAGGACCAACTGG
CGGCCCTACTGTACGGAAGTTTCCGAGACGCGCTGAACAATTCCCTTGCTACCGTAACTGCGCCATTCCCCTGATTTACA
GTTATGCGAAAAATACGCCCCACGACTTGCAAATTTGCCTCTTCAGAGTCACTGTACAGGTTCCAAAAGATTGTGGATTA
AGCATGGAATAACGTGTATAGAACCTTGAAATAAACTGGTGGGGAAATACAAAAAAAAAAAAAAAAAAAA

Also this one with no error but no results either:
GGGGTGGCATGGCATTAGGCCGGGGATCCTGCAAAGTGAAGAATATTTCCTGGTCTATCCCCTTTCACNAAAGTATTTGC
CTGGGCAATCCAACAGGGTGTGTCCAAGGCTGTCTCNCATGGTGTGGGGGCCCTAATTAACAAGGGATAAATCAGCAGTA
TTTCCNTCCAACACTGGNACNCNAATAAAGTATGTGNNCCCCACGAAAAAAAAAAAAAAAAAAAA

Here is the tail of some output on the screen when running the first
sequence which probably shows the parameters passed to Blast:

........NATGGCATTAGGCCGGGGGACGCTTCGAGNTANCCGCATCGCCGANTTCCGCAANTCAGTTGTGNGCTAC
TTCCA%00A02_DVMGL_P1DVM-contig_58%00&WORD+SIZE=11&EXPECT=1e-10&SERVICE=plain&
FORMAT_OBJECT=Alignment&CMD=Put&CDD_SEARCH=off&PROGRAM=blastn

Thanks for your time,

Affan

> nt is usually used for nucleotide BLAST ... that came across backwards
> :)
>
> JO
>
>
> On Sun, 7 Nov 2004 22:41:02 -0600, Joshua Orvis <jorvis at gmail.com>
> wrote:
>> I get different things with it when I use nr as the database rather
>> than nt when doing nucleotide BLAST.  Try that.  What's your sequence
>> (just in case)?
>>
>> JO
>>
>>
>>
>>
>> On Sun, 7 Nov 2004 21:58:43 -0500 (EST), affan qureshi
>> <aqureshi at cs.odu.edu> wrote:
>> > Hi,
>> > I am trying to use the Remote Blast example for my own Nucleotide
>> sequence but I get No Significant Matches found response from the
>> server. However the same query gives me matches for the web-based
>> interface
>> > "Nucleotide-nucleotide BLAST (blastn)" on the NCBI website.
>> >
>> > Do you know what I could be doing wrong? I searched the archive but
>> saw a similar question for which i couldnt find the answer. Also is
>> there a way to see the actual parameters being passed to the server
>> and compare them with the web-based ones?
>> >
>> > Thanks a lot,
>> >
>> > Affan
>> >
>> > Here is my code:
>> >
>> > sub doBlast {
>> >         #this is the filename containing nucleotide sequence
>> >         my($filename) = @_;
>> >
>> >         my $prog = 'blastn';
>> >         my $db   = 'nr';
>> >         my $e_val= '1e-10';
>> >
>> >         my @params = ( '-prog' => $prog,
>> >                         '-data' => $db,
>> >                         '-expect' => $e_val,
>> >                         '-readmethod' => 'SearchIO' );
>> >
>> >         my $factory = Bio::Tools::Run::RemoteBlast->new(@params);
>> >
>> >         #change a paramter
>> >         #$Bio::Tools::Run::RemoteBlast::HEADER{'ENTREZ_QUERY'} =
>> 'Homo sapiens
>> > [ORGN]';
>> >
>> >         #remove a parameter
>> >         #delete $Bio::Tools::Run::RemoteBlast::HEADER{'FILTER'};
>> >
>> >         my $v = 1;
>> >         #$v is just to turn on and off the messages
>> >
>> >         my $seqio = Bio::SeqIO->new(-file=>$filename, '-format' =>
>> 'fasta' );
>> >
>> >         while (my $input = $seqio->next_seq()) {
>> >
>> >                 #Blast a sequence against a database:
>> >
>> >                 my $r = $factory->submit_blast($input);
>> >
>> >                 print STDERR "waiting..." if( $v > 0 );
>> >                 while ( my @rids = $factory->each_rid ) {
>> >                 foreach my $rid ( @rids ) {
>> >                         my $rc = $factory->retrieve_blast($rid);
>> if(
>> !ref($rc) ) {
>> >                                 if( $rc < 0 ) {
>> >                                         $factory->remove_rid($rid);
>> >                                 }
>> >                                 print STDERR "." if ( $v > 0 );
>> sleep 5;
>> >                         } else {
>> >                                 my $result = $rc->next_result();
>> #save the output
>> >                                 my $filename =
>> 'results/'.$result->query_name().".blast";
>> $factory->save_output($filename);
>> $factory->remove_rid($rid);
>> >                                 print "\nQuery Name: ",
>> $result->query_name(), "\n"; while (
>> my $hit = $result->next_hit ) {
>> >                                         next unless ( $v > 0);
>> print
>> "\thit name is ",
>> $hit->name, "\n"; while( my
>> $hsp = $hit->next_hsp ) {
>> print "\t\tscore is ",
>> $hsp->score, "\n"; }
>> >                                 }
>> >                         }
>> >                 }
>> >                 }
>> >         }
>> >
>> > }
>> >
>> > _______________________________________________
>> > Bioperl-l mailing list
>> > Bioperl-l at portal.open-bio.org
>> > http://portal.open-bio.org/mailman/listinfo/bioperl-l
>> >





More information about the Bioperl-l mailing list