[Bioperl-l] RemoteBlast

[Brian Osborne]

William,

There are people here who are happy to help but you need to show some code,
your letter is not very informative.

Brian O.

-----Original Message-----
From: bioperl-l-bounces at portal.open-bio.org
[mailto:bioperl-l-bounces at portal.open-bio.org]On Behalf Of william ritchie
Sent: Friday, January 23, 2004 12:47 PM
To: bioperl-l at bioperl.org
Subject: [Bioperl-l] RemoteBlast

Hi I m getting this error message:

-------------------- WARNING ---------------------
MSG: seq doesn't validate, mismatch is 1
---------------------------------------------------

------------- EXCEPTION  -------------
MSG: Attempting to set the sequence to
[ADRA2ANM_007417ATGGGCTCACTGCAGCCGGATGCCGGCAACAGCAGCTGGAACGGGACCGAAGCGCCCGGA
GGCGGC


but my input is regular FASTA!!!!!!!
Help please.

_________________________________________________________________
Do You Yahoo!? -- Une adresse @yahoo.fr gratuite et en français !
Yahoo! Mail : http://fr.mail.yahoo.com
_______________________________________________
Bioperl-l mailing list
Bioperl-l at portal.open-bio.org
http://portal.open-bio.org/mailman/listinfo/bioperl-l