[Bioperl-l] RemoteBlast
william ritchie
billthebrute at yahoo.fr
Fri Jan 23 12:47:26 EST 2004
Hi I m getting this error message:
-------------------- WARNING ---------------------
MSG: seq doesn't validate, mismatch is 1
---------------------------------------------------
------------- EXCEPTION -------------
MSG: Attempting to set the sequence to
[ADRA2ANM_007417ATGGGCTCACTGCAGCCGGATGCCGGCAACAGCAGCTGGAACGGGACCGAAGCGCCCGGAGGCGGC
but my input is regular FASTA!!!!!!!
Help please.
_________________________________________________________________
Do You Yahoo!? -- Une adresse @yahoo.fr gratuite et en français !
Yahoo! Mail : http://fr.mail.yahoo.com
More information about the Bioperl-l
mailing list