[Bioperl-l] Bio::Tools::BPbl2seq Parsing bl2seq

[Jason Stajich]

I'd use Bio::SearchIO, format 'blast' instead of BPbl2seq.

But anyways...

You want to protect the calls with a while loop:
  while( my $hsp = $report->next_feature ) {

  }
Because if there are no alignments you'll get an error like you just 
saw.

Passing option " -report_type => 'blastn'  " is necessary for guessing 
how to do the strandedness correctly.

-jason
On Dec 13, 2004, at 7:13 AM, Harry Noyes wrote:

> I am trying to parse a bl2seq output file using Bio::Tools::BPbl2seq  
> and I get the followoing error message:
> Can't call method "nextHSP" on unblessed reference at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/BPbl2seq.pm line 243, <GEN0> 
> line 7.
>
> The error is generated when I run this script
>
>
> use Bio::Tools::BPbl2seq;
>   my $report = Bio::Tools::BPbl2seq->new(
>                                          -file => 'temp.txt');
>   $report->sbjctName;
>   $report->sbjctLength;
>   my $hsp = $report->next_feature;
>   my $S_start =   $hsp->sbjct->start;
>   my $S_end   =   $hsp->sbjct->end;
>
>
> if ($S_start) {print "Start $S_start \n";}
>
>
> Since I am a beginner at this,I am probably doing something stupid.
> The file I am parsing is below and was generated with the statement:
> system("/usr/local/genome/blast/bl2seq -i $probe_file -j 
> target_file.txt -p blastn -o temp.txt");
>
> .
> I have also tried inserting a statement      "   -format => 'blastn',  
> "        before the     "   -file =>   "   statement but I still get 
> the Warning  message and the message about the unblessed reference.
> Any  help would be much appreciated.
> Thanks
>
> Harry
>
> ######################################################################
> #COMMAND LINE OUTPUT
>
> perl blast_parser_test.pl
>
> -------------------- WARNING ---------------------
> MSG: Must provide which type of BLAST was run (blastp,blastn, tblastn, 
> tblastx, blastx) if you want strand information to get set properly 
> for DNA query or subjects
> ---------------------------------------------------
> Can't call method "nextHSP" on unblessed reference at 
> /usr/lib/perl5/site_perl/5.8.0/Bio/Tools/BPbl2seq.pm line 243, <GEN0> 
> line 7.
>
> ######################################################################
> #INPUT FILE (I HAVE OMMITTED MINOR ALIGNMENTS)
> Query=
>          (250 letters)
>
> >
>           Length = 105880
>
>  Score =  496 bits (250), Expect = e-142
>  Identities = 250/250 (100%)
>  Strand = Plus / Minus
>
>
> Query: 1    
> acctgctagagccttgatctgggaatctaagttttcataattatgaacaataaatttatg 60
>             
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 3962 
> acctgctagagccttgatctgggaatctaagttttcataattatgaacaataaatttatg 3903
>
>
> Query: 61   
> ttatttataaactacccgatataagatattttattacagcagcaagaatggactaagatg 120
>             
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 3902 
> ttatttataaactacccgatataagatattttattacagcagcaagaatggactaagatg 3843
>
>
> Query: 121  
> agtgcaaaatctgagaaggaaaccacaggtacctgcaagtactggaatattccataattg 180
>             
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 3842 
> agtgcaaaatctgagaaggaaaccacaggtacctgcaagtactggaatattccataattg 3783
>
>
> Query: 181  
> attaggtgggagtttaaatgtaagacagtaagttatattgctaaatatgaatgctgaggt 240
>             
> ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> Sbjct: 3782 
> attaggtgggagtttaaatgtaagacagtaagttatattgctaaatatgaatgctgaggt 3723
>
>
> Query: 241  cctccctaaa 250
>             ||||||||||
> Sbjct: 3722 cctccctaaa 3713
>
>
>
>  Score = 28.2 bits (14), Expect = 0.079
>  Identities = 14/14 (100%)
>  Strand = Plus / Plus
>
>
> Query: 34   ttcataattatgaa 47
>             ||||||||||||||
> Sbjct: 3916 ttcataattatgaa 3929
>
> Lambda     K      H
>     1.37    0.711     1.31
>
> Gapped
> Lambda     K      H
>     1.37    0.711     1.31
>
>
> Matrix: blastn matrix:1 -3
> Gap Penalties: Existence: 5, Extension: 2
> Number of Hits to DB: 15
> Number of Sequences: 0
> Number of extensions: 15
> Number of successful extensions: 15
> Number of sequences better than 10.0: 1
> Number of HSP's better than 10.0 without gapping: 1
> Number of HSP's successfully gapped in prelim test: 0
> Number of HSP's that attempted gapping in prelim test: 0
> Number of HSP's gapped (non-prelim): 15
> length of query: 250
> length of database: 105,880
> effective HSP length: 12
> effective length of query: 238
> effective length of database: 105,868
> effective search space: 25196584
> effective search space used: 25196584
> T: 0
> A: 0
> X1: 6 (11.9 bits)
> X2: 15 (29.7 bits)
> S1: 12 (24.3 bits)
> S2: 11 (22.3 bits)
>
>
>
> *******************************NOTE NEW ADDRESS AND PHONE 
> NUMBERS*****************
> Harry Noyes
> Room 231
> Biosciences Building
> School of Biological Sciences,
> University of Liverpool,
> Crown St.
> Liverpool
> L69 7ZB
> Internal 7334
> Tel  0151-794-7334
> Fax 0151-795-4408
> email harry at liv.ac.uk
> http://www.genomics.liv.ac.uk/
>
>
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l at portal.open-bio.org
> http://portal.open-bio.org/mailman/listinfo/bioperl-l
>
>
--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/