[Bioperl-l] Bio::Tools::BPbl2seq Parsing bl2seq

[Harry Noyes]

I am trying to parse a bl2seq output file using Bio::Tools::BPbl2seq  and I 
get the followoing error message:
Can't call method "nextHSP" on unblessed reference at 
/usr/lib/perl5/site_perl/5.8.0/Bio/Tools/BPbl2seq.pm line 243, <GEN0> line 7.

The error is generated when I run this script


use Bio::Tools::BPbl2seq;
   my $report = Bio::Tools::BPbl2seq->new(
                                          -file => 'temp.txt');
   $report->sbjctName;
   $report->sbjctLength;
   my $hsp = $report->next_feature;
   my $S_start =   $hsp->sbjct->start;
   my $S_end   =   $hsp->sbjct->end;


if ($S_start) {print "Start $S_start \n";}


Since I am a beginner at this,I am probably doing something stupid.
The file I am parsing is below and was generated with the statement:
system("/usr/local/genome/blast/bl2seq -i $probe_file -j target_file.txt -p 
blastn -o temp.txt");

.
I have also tried inserting a statement      "   -format => 
'blastn',  "        before the     "   -file =>   "   statement but I still 
get the Warning  message and the message about the unblessed reference.
Any  help would be much appreciated.
Thanks

Harry

######################################################################
#COMMAND LINE OUTPUT

perl blast_parser_test.pl

-------------------- WARNING ---------------------
MSG: Must provide which type of BLAST was run (blastp,blastn, tblastn, 
tblastx, blastx) if you want strand information to get set properly for DNA 
query or subjects
---------------------------------------------------
Can't call method "nextHSP" on unblessed reference at 
/usr/lib/perl5/site_perl/5.8.0/Bio/Tools/BPbl2seq.pm line 243, <GEN0> line 7.

######################################################################
#INPUT FILE (I HAVE OMMITTED MINOR ALIGNMENTS)
Query=
          (250 letters)

 >
           Length = 105880

  Score =  496 bits (250), Expect = e-142
  Identities = 250/250 (100%)
  Strand = Plus / Minus


Query: 1    acctgctagagccttgatctgggaatctaagttttcataattatgaacaataaatttatg 60
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3962 acctgctagagccttgatctgggaatctaagttttcataattatgaacaataaatttatg 3903


Query: 61   ttatttataaactacccgatataagatattttattacagcagcaagaatggactaagatg 120
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3902 ttatttataaactacccgatataagatattttattacagcagcaagaatggactaagatg 3843


Query: 121  agtgcaaaatctgagaaggaaaccacaggtacctgcaagtactggaatattccataattg 180
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3842 agtgcaaaatctgagaaggaaaccacaggtacctgcaagtactggaatattccataattg 3783


Query: 181  attaggtgggagtttaaatgtaagacagtaagttatattgctaaatatgaatgctgaggt 240
             ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3782 attaggtgggagtttaaatgtaagacagtaagttatattgctaaatatgaatgctgaggt 3723


Query: 241  cctccctaaa 250
             ||||||||||
Sbjct: 3722 cctccctaaa 3713



  Score = 28.2 bits (14), Expect = 0.079
  Identities = 14/14 (100%)
  Strand = Plus / Plus


Query: 34   ttcataattatgaa 47
             ||||||||||||||
Sbjct: 3916 ttcataattatgaa 3929

Lambda     K      H
     1.37    0.711     1.31

Gapped
Lambda     K      H
     1.37    0.711     1.31


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 15
Number of Sequences: 0
Number of extensions: 15
Number of successful extensions: 15
Number of sequences better than 10.0: 1
Number of HSP's better than 10.0 without gapping: 1
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 0
Number of HSP's gapped (non-prelim): 15
length of query: 250
length of database: 105,880
effective HSP length: 12
effective length of query: 238
effective length of database: 105,868
effective search space: 25196584
effective search space used: 25196584
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 11 (22.3 bits)



*******************************NOTE NEW ADDRESS AND PHONE 
NUMBERS*****************
Harry Noyes
Room 231
Biosciences Building
School of Biological Sciences,
University of Liverpool,
Crown St.
Liverpool
L69 7ZB
Internal 7334
Tel  0151-794-7334
Fax 0151-795-4408
email harry at liv.ac.uk
http://www.genomics.liv.ac.uk/