[Bioperl-l] Re: Extracting Raw Score Value from Blast Output

[Jason Stajich]

In the future it is helpful to post code that you are using.  I suspect 
you are calling $hit->raw_score which is the overall value for the HIT 
not the HSP.  If you want the score for the HSP you should call 
$hsp->score.

http://bioperl.org/HOWTOs/SearchIO/use.html is a good place to start 
seeing where values get stored.

-jason
On Dec 9, 2004, at 3:28 PM, Waibhav Tembe wrote:

> Hello,
>
> I am relatively new to BLAST and BioPerl. Apologies if this 
> question/observation is trivial or I have made any basic mistake.
>
> I am parsing BLAST output using *bioperl-1.4::Bio::Search::Hit* 
> <toc.html>.
> For a given hit, I would like to extract raw score, bit score and 
> other information. Using
> ->raw_score
> ->Bits
> for a hit. Here is what I observed. (Just pasting relevant info from 
> BLAST output)
> ================================================
> Query= PA008
>        (35 letters)
> Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
> GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
>          2,718,617 sequences; 12,254,801,043 total letters
> Searching..................................................done
>                                                                Score   
>  E
> Sequences producing significant alignments:                      
> (bits) Value
> gb|CP000001.1| Bacillus cereus ZK, complete genome                     
> 70   2e-10
> omitted all other records ..........
> >gb|CP000001.1| Bacillus cereus ZK, complete genome
>         Length = 5300915
> Score = 69.9 bits (35), Expect = 2e-10
> Identities = 35/35 (100%)
> Strand = Plus / Plus
> Query: 1       ttaacgaagcatcgcgaagagcacgttcaattgga 35
>              |||||||||||||||||||||||||||||||||||
> Sbjct: 3032643 ttaacgaagcatcgcgaagagcacgttcaattgga 3032677
> ---------------------------------------------
> For the above BLAST section, I generated the following statistics 
> using BioPerl.
> Query Name = PA008
> Lambda=1.37, Kappa=0.711, Base Match Reward=1
> Checking Hit [1]Raw Score=      70      BitScore=69.9   EValue=2e-10   
>  Bacillus cereus ZK, complete genome
>
> I was expecting Raw Score = 35 and NOT 70.  Is raw_score output by 
> BioPerl's implementation calculated differently? Am I reading BLAST 
> output incorreclty?
>
> Thanks!
>
> -waibhav
>
> -- 
> Waibhav Tembe.
>
>
--
Jason Stajich
jason.stajich at duke.edu
http://www.duke.edu/~jes12/