[Bioperl-l] more on the bl2seq error

[Steven Cannon]

Hello,

Here is a bit more information on the bl2seq error that I described on 
March 12. It does genuinely seem to be data-independent. Here is a very 
minimal script that produces the problem: blast a sequence (protein or 
nucleotide) against itself 300 times. The crash occurs near hit 250 
(I've also seen 247, 248, and 249, in different program contexts). 
Again: this is in Bioperl 1.02 and 1.2, on OS X .

use strict;
use Bio::SeqIO;
use Bio::Tools::BPbl2seq;
use Bio::Tools::Run::StandAloneBlast;
my $seq1 = Bio::Seq->new(
   '-id'=>"seq1",
   
'-seq'=>"atcgttcgaataccggcttaagctagtctgcattaaggctggaaccatcgttcnaataccgg"
);
my $factory = Bio::Tools::Run::StandAloneBlast->new('program' => 
'blastn');
my $counter = 0;
for (my $i = 0; $i < 300; $i++) {
   $counter++;
   my $bl2seq_report = $factory->bl2seq($seq1, $seq1);
   my $hsp = $bl2seq_report->next_feature; # report only the top HSP
   my $P = $hsp->P;
   print "$counter $P\n";
}

=item

Error:

248 1e-32
249 1e-32
[bl2seq] WARNING:  [000.000]  Unable to open BLOSUM62
[bl2seq] WARNING:  [000.000]  BlastScoreBlkMatFill returned non-zero 
status
[bl2seq] WARNING:  [000.000]  SetUpBlastSearch failed.

------------- EXCEPTION  -------------
MSG:  No hit object found for bl2seq report

STACK Bio::Tools::BPbl2seq::next_feature 
/Library/Perl/Bio/Tools/BPbl2seq.pm:231
STACK toplevel 
/Users/steven/scperl2/ProgramControl/bl2seq/bl2seq0.02d_test.pl:20

--------------------------------------