[Bioperl-l] tr/// and eval

[Heikki Lehvaslaiho]

Pat,

The following script is a bit more "perlish" way of doing it.

	-Heikki


#!/usr/bin/perl

use strict;

my $ecoli="GAAGTCGTAACAAGGTAACCGTAGGGGAACCT";

my $offset = 0;
my %res;

while ($offset < length($ecoli)) {
    my $n = uc substr($ecoli, $offset, 1);
    $res{$n}++;
    $offset++;
}


On Thu, 2002-10-10 at 13:33, Pat Schloss wrote:
> Hi all, 
> 
> I'm trying to write a program with the simple task of counting the
> number of A's, T's, G's, and C's (and binary combinations of those
> letters, i.e. AA, AG, AC...) in a DNA sequence string.  I'm still in the
> process of trying to gain some level of proficiency with perl so I'd
> rather not use a module at this point.  Hopefully someone can help with
> my problem. 
> 
> What I'd like to do pretty much expressed in the code below.  The
> problem I'm having is that when I do the tr/// I'm trying to interpolate
> into the search a different letter of my modified alphabet.  When I
> looked at Programming Perl, it says you have to use the eval function to
> interpolate a search variable.  Wall, et al. show how to do it if the
> string being used is $_, but not if the string is some other variable,
> $ecoli in my case.  The $_ value I'm using is the different values of my
> alphabet.  So, I'm not sure where to put the "eval" or if what I'm doing
> is possible (sure it is!).  I've moved the eval around but can't get
> anything to work.  Help!? 
> 
> Pat 
> 
> #!/usr/bin/perl 
> $ecoli=GAAGTCGTAACAAGGTAACCGTAGGGGAACCT"; 
> 
> my @alphabet=qw* A T G C*; 
> 
> foreach (@alphabet) { 
> ${$_} = ($ecoli=~ tr/$_//); 
> print "$_, ${$_}\n"; 
> } 
> 
> print "a= $A, t= $T, g=$G, c=$C\n"; 
> 
> 
> 
> 
> 
> 
> _______________________________________________
> Bioperl-l mailing list
> Bioperl-l@bioperl.org
> http://bioperl.org/mailman/listinfo/bioperl-l
-- 
______ _/      _/_____________________________________________________
      _/      _/                      http://www.ebi.ac.uk/mutations/
     _/  _/  _/  Heikki Lehvaslaiho          heikki@ebi.ac.uk
    _/_/_/_/_/  EMBL Outstation, European Bioinformatics Institute
   _/  _/  _/  Wellcome Trust Genome Campus, Hinxton
  _/  _/  _/  Cambs. CB10 1SD, United Kingdom
     _/      Phone: +44 (0)1223 494 644   FAX: +44 (0)1223 494 468
___ _/_/_/_/_/________________________________________________________