[Bioperl-l] BLAST Parsing Bug?

Paul Boutros pcboutro@engmail.uwaterloo.ca
Tue, 20 Aug 2002 14:18:21 -0400 (EDT)


Okay, same code, new Blast record, new error.  The new blast record was
run with parameters:
-l (restricting it to a subset of GIs)
-v 10 (restrict to 10 hits)
-e 0.3 (expectation value)

The error seems to be suggesting that there is an empty line somewhere
where it isn't expected (i.e. midline = "\n").

Any comments?  I've followed the suggestion of testing this both with
ActiveState and by downloading the libraries and installing them directly.
I get the same results either way.

I also verified all the dependencies are present and up-to-date.

Paul


error:
------------- EXCEPTION  -------------
MSG: no data for midline   Subset of the database(s) listed below
STACK Bio::SearchIO::blast::next_result
C:/Perl/site/lib/Bio/SearchIO/blast.pm:5
66
STACK toplevel blastp~1.pl:9
--------------------------------------

new blast file:
BLASTN 2.2.3 [Apr-24-2002]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= H3001A01-3(C0001A09-3)
         (362 letters)

Database: est_others 
           5,032,538 sequences; 2,449,699,975 total letters



                                                                 Score
E
Sequences producing significant alignments:                      (bits)
Value

gb|BI292210.1|BI292210 UI-R-DN0-civ-m-09-0-UI.s1 UI-R-DN0 Rattus...   274
1e-072
gb|BF290726.1|BF290726 EST455317 Rat Gene Index, normalized rat,...   266
3e-070
gb|BI301460.1|BI301460 UI-R-DN0-cit-e-07-0-UI.s1 UI-R-DN0 Rattus...   260
2e-068

>gb|BI292210.1|BI292210 UI-R-DN0-civ-m-09-0-UI.s1 UI-R-DN0 Rattus
norvegicus cDNA clone
           UI-R-DN0-civ-m-09-0-UI 3'
          Length = 468

 Score =  274 bits (138), Expect = 1e-072
 Identities = 168/178 (94%)
 Strand = Plus / Plus

                                                                       
Query: 1   aagatttatttatttattccatgtataggaatacactgtagctgtcttcagacacaccag 60
           ||||||||||||||||||  ||| ||| |||||||||||||||||||||||| |||||||
Sbjct: 20  aagatttatttatttattttatgcatatgaatacactgtagctgtcttcagatacaccag 79

                                                                       
Query: 61  aagagggcatcagatctcattgcagatggctgtgagccaccatgtggttgctgggatttg
120
           ||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||||||||
Sbjct: 80  aagagggcatcagatcttattacagatggttgtgagccaccatgtggttgctgggatttg
139

                                                                     
Query: 121 aactcaggacctctggaagagcagtcggtgctcttaaccgctgagccatctctccagc 178
           |||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||
Sbjct: 140 aactcaggacctctggaagagcagtcagtgctcttaaccactgagccatctctccagc 197


>gb|BF290726.1|BF290726 EST455317 Rat Gene Index, normalized rat, Rattus
norvegicus cDNA
           Rattus norvegicus cDNA clone RGIIB68 3' sequence
          Length = 223

 Score =  266 bits (134), Expect = 3e-070
 Identities = 167/178 (93%)
 Strand = Plus / Plus

                                                                       
Query: 1   aagatttatttatttattccatgtataggaatacactgtagctgtcttcagacacaccag 60
           |||||||||||||||||| |||||||  || |||||||||||||||||||||||||||||
Sbjct: 1   aagatttatttatttatttcatgtatgtgagtacactgtagctgtcttcagacacaccag 60

                                                                       
Query: 61  aagagggcatcagatctcattgcagatggctgtgagccaccatgtggttgctgggatttg
120
           |||||||||||||||| |||  | ||||| |||||| ||||||||||||||||||| |||
Sbjct: 61  aagagggcatcagatcccatcacggatggttgtgaggcaccatgtggttgctgggaattg
120

                                                                     
Query: 121 aactcaggacctctggaagagcagtcggtgctcttaaccgctgagccatctctccagc 178
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 121 aactcaggacctctggaagagcagtcggtgctcttaaccgctgagccatctctccagc 178


>gb|BI301460.1|BI301460 UI-R-DN0-cit-e-07-0-UI.s1 UI-R-DN0 Rattus
norvegicus cDNA clone
           UI-R-DN0-cit-e-07-0-UI 3'
          Length = 524

 Score =  260 bits (131), Expect = 2e-068
 Identities = 164/175 (93%)
 Strand = Plus / Plus

                                                                       
Query: 4   atttatttatttattccatgtataggaatacactgtagctgtcttcagacacaccagaag 63
           |||||||||||||||   | |||| || |||| |||||||||||||||||||||||||||
Sbjct: 210 atttatttatttatttattatatatgagtacattgtagctgtcttcagacacaccagaag
269

                                                                       
Query: 64  agggcatcagatctcattgcagatggctgtgagccaccatgtggttgctgggatttgaac
123
           |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||
Sbjct: 270 agggcatcagatctcattacagatggttgtgagccaccatgtggttgctgggatttgaac
329

                                                                  
Query: 124 tcaggacctctggaagagcagtcggtgctcttaaccgctgagccatctctccagc 178
           ||||||||||||||||||||||| ||||||||||||||||||||| |||||||||
Sbjct: 330 tcaggacctctggaagagcagtcagtgctcttaaccgctgagccacctctccagc 384




  Subset of the database(s) listed below
     Number of letters searched: 123,827,604
     Number of sequences searched:  285,629
  
  Database: est_others
    Posted date:  Aug 15, 2002 12:08 PM
  Number of letters in database: 333,332,922
  Number of sequences in database:  0
  
  Database: c:\docume~1\paul\blast\data\est_others.01
    Posted date:  Aug 15, 2002 12:21 PM
  Number of letters in database: 333,333,126
  Number of sequences in database:  734,123
  
  Database: c:\docume~1\paul\blast\data\est_others.02
    Posted date:  Aug 15, 2002 12:33 PM
  Number of letters in database: 333,332,951
  Number of sequences in database:  710,185
  
  Database: c:\docume~1\paul\blast\data\est_others.03
    Posted date:  Aug 15, 2002 12:45 PM
  Number of letters in database: 333,332,998
  Number of sequences in database:  651,575
  
  Database: c:\docume~1\paul\blast\data\est_others.04
    Posted date:  Aug 15, 2002 12:56 PM
  Number of letters in database: 333,332,826
  Number of sequences in database:  637,159
  
  Database: c:\docume~1\paul\blast\data\est_others.05
    Posted date:  Aug 15, 2002  1:07 PM
  Number of letters in database: 333,333,104
  Number of sequences in database:  630,795
  
  Database: c:\docume~1\paul\blast\data\est_others.06
    Posted date:  Aug 15, 2002  1:19 PM
  Number of letters in database: 333,332,943
  Number of sequences in database:  650,535
  
  Database: c:\docume~1\paul\blast\data\est_others.07
    Posted date:  Aug 15, 2002  1:28 PM
  Number of letters in database: 116,369,105
  Number of sequences in database:  227,351
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 49,566
Number of Sequences: 4241723
Number of extensions: 49566
Number of successful extensions: 21421
Number of sequences better than  0.3: 2335
length of query: 362
length of database: 123,827,604
effective HSP length: 18
effective length of query: 344
effective length of database: 118,686,282
effective search space: 40828081008
effective search space used: 40828081008
T: 0
A: 40
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
BLASTN 2.2.3 [Apr-24-2002]




On Tue, 20 Aug 2002, Jason Stajich wrote:

> Because the parser expects to be parsing a full blast report - you are
> only providing it with a report which has hits but no hsps.
> 
> At some point we can adapt the module to parse these types of reports, but
> for now it is only going to work with reports that have the full
> alignments included.
> 
> -jason
> 
> On Tue, 20 Aug 2002, Paul Boutros wrote:
> 
> > Hello,
> >
> > I am just starting with Bioperl, trying to evaluate how useful it will be
> > for our group.  I'm struggling with getting it to work on my first few
> > steps here, though.  I would like to use the SearchIO system to parse a
> > blast-results file and I can strange results.
> >
> > System: Win2k Pro (sp3)
> > Perl: 5.6.1 ActiveState build 631 (all packages are updated)
> > BioPerl: 1.00.2
> >
> > The basic problem is that the parser isn't finding any of the hits.  At
> > all.  So the code below comes back with $count=0 for every record in the
> > BLAST output file.  Any ideas what I'm doing wrong?
> >
> > Paul
> >
> >
> > Code:
> > use strict;
> > use Bio::SearchIO;
> >
> > my $searchio = new Bio::SearchIO(
> > 			'-format'	=> 'blast',
> > 			'-file'		=> '15k5prime.out',
> > 			);
> >
> > while (my $result = $searchio->next_result()) {
> >
> > 	my $count = 0;
> >
> > 	print "Name: ", $result->query_name(), "\n";
> >
> > 	while (my $hit = $result->next_hit()) {
> > 		$count++;
> > 		}
> >
> > 	print "Count: $count\n";
> >
> > 	}
> >
> > Blast File Fragment:
> >
> > BLASTN 2.2.3 [Apr-24-2002]
> >
> >
> > Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
> > Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
> > "Gapped BLAST and PSI-BLAST: a new generation of protein database search
> > programs",  Nucleic Acids Res. 25:3389-3402.
> >
> > Query= H3001A01-5
> >          (589 letters)
> >
> > Database: est_others
> >            5,032,538 sequences; 2,449,699,975 total letters
> >
> >
> >
> >                                                                  Score
> > E
> > Sequences producing significant alignments:                      (bits)
> > Value
> >
> > gb|BQ206993.1|BQ206993 UI-R-DZ1-cnm-h-16-0-UI.s1 UI-R-DZ1 Rattus...   200
> > 3e-050
> > gb|BM386877.1|BM386877 UI-R-CN1-cjh-d-20-0-UI.s1 UI-R-CN1 Rattus...   198
> > 1e-049
> > gb|BI301905.1|BI301905 UI-R-DL0-cio-k-03-0-UI.s1 UI-R-DL0 Rattus...   198
> > 1e-049
> > gb|BI301460.1|BI301460 UI-R-DN0-cit-e-07-0-UI.s1 UI-R-DN0 Rattus...   198
> > 1e-049
> > gb|BG371847.1|BG371847 UI-R-CV0-brj-a-09-0-UI.s1 UI-R-CV0 Rattus...   198
> > 1e-049
> > gb|BE115424.1|BE115424 UI-R-BS1-axu-f-02-0-UI.s1 UI-R-BS1 Rattus...   198
> > 1e-049
> > gb|AA819696.1|AA819696 UI-R-A0-bh-d-10-0-UI.s1 UI-R-A0 Rattus no...   192
> > 6e-048
> > gb|BM383271.1|BM383271 UI-R-DS0-cje-i-16-0-UI.s1 UI-R-DS0 Rattus...   190
> > 2e-047
> > gb|BI292210.1|BI292210 UI-R-DN0-civ-m-09-0-UI.s1 UI-R-DN0 Rattus...   190
> > 2e-047
> > gb|BI284655.1|BI284655 UI-R-DE0-cac-f-05-0-UI.s1 UI-R-DE0 Rattus...   190
> > 2e-047
> >
> >   Subset of the database(s) listed below
> >      Number of letters searched: 123,827,604
> >      Number of sequences searched:  285,629
> >
> >   Database: est_others
> >     Posted date:  Aug 15, 2002 12:08 PM
> >   Number of letters in database: 333,332,922
> >   Number of sequences in database:  0
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.01
> >     Posted date:  Aug 15, 2002 12:21 PM
> >   Number of letters in database: 333,333,126
> >   Number of sequences in database:  734,123
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.02
> >     Posted date:  Aug 15, 2002 12:33 PM
> >   Number of letters in database: 333,332,951
> >   Number of sequences in database:  710,185
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.03
> >     Posted date:  Aug 15, 2002 12:45 PM
> >   Number of letters in database: 333,332,998
> >   Number of sequences in database:  651,575
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.04
> >     Posted date:  Aug 15, 2002 12:56 PM
> >   Number of letters in database: 333,332,826
> >   Number of sequences in database:  637,159
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.05
> >     Posted date:  Aug 15, 2002  1:07 PM
> >   Number of letters in database: 333,333,104
> >   Number of sequences in database:  630,795
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.06
> >     Posted date:  Aug 15, 2002  1:19 PM
> >   Number of letters in database: 333,332,943
> >   Number of sequences in database:  650,535
> >
> >   Database: c:\docume~1\paul\blast\data\est_others.07
> >     Posted date:  Aug 15, 2002  1:28 PM
> >   Number of letters in database: 116,369,105
> >   Number of sequences in database:  227,351
> >
> > Lambda     K      H
> >     1.37    0.711     1.31
> >
> > Gapped
> > Lambda     K      H
> >     1.37    0.711     1.31
> >
> >
> > Matrix: blastn matrix:1 -3
> > Gap Penalties: Existence: 5, Extension: 2
> > Number of Hits to DB: 69,708
> > Number of Sequences: 4241723
> > Number of extensions: 69708
> > Number of successful extensions: 25280
> > Number of sequences better than  0.3: 2163
> > length of query: 589
> > length of database: 123,827,604
> > effective HSP length: 18
> > effective length of query: 571
> > effective length of database: 118,686,282
> > effective search space: 67769867022
> > effective search space used: 67769867022
> > T: 0
> > A: 40
> > X1: 6 (11.9 bits)
> > X2: 15 (29.7 bits)
> > S1: 12 (24.3 bits)
> > S2: 19 (38.2 bits)
> > BLASTN 2.2.3 [Apr-24-2002]
> >
> >
> >
> >
> > _______________________________________________
> > Bioperl-l mailing list
> > Bioperl-l@bioperl.org
> > http://bioperl.org/mailman/listinfo/bioperl-l
> >
> 
> -- 
> Jason Stajich
> Duke University
> jason at cgt.mc.duke.edu
>