[Bioperl-l] (no subject)

[Parminder Kang]

hi,
i am new to bioperl, trying to run local blast, but running into some 
problems.

so far i have this

use Bio::Tools::Run::StandAloneBlast();
@params = ('program'=> 'blastn',
	  'database' => 'gpcr_nt.fasta');
my $factory = Bio::Tools::Run::StandAloneBlast->new(@params);

my $input = Bio::Seq->new('-id'=>"test query",
		       '-seq' =>"atggagcccaagcaaggaattctaaggg");
my $blast_report = $factory->blastall($input);

while(my $sbjct = $blast_report->nextSbjct) {
   # print "$sbjct"
My problem is that when now I print the $sbjct, I only get Hash references.
May be I have to add something to the script I did not see anything else in 
the documentation.
If anyone sees the  what the problem is please let me know. If you have 
examples scripts that would be helpful too. Also is this the best way to run 
the local blast.
Thanks
PK
_________________________________________________________________
Get your FREE download of MSN Explorer at http://explorer.msn.com