[Bioperl-l] Location bug for features with sub_SeqFeatures?

[Hilmar Lapp]

"Gosink, Mark (SEA)" wrote:
> 
> Thanks for the suggestion, unfortunately it didn't seem to work for more
> than 1 sub_feature. Here is the script with multiple sub_features:
> 
> use Bio::SeqFeature::Generic;
> use Bio::Seq;
> use Bio::SeqIO;
> 
> my $feat = Bio::SeqFeature::Generic->new(-primary => "test");
> my $seq = Bio::Seq->new(-seq => "agctacgaccttgatcgcta", -id =>"test01");
> 
> # add sub-features to the feature
> $feat->add_sub_SeqFeature(Bio::SeqFeature::Generic->new(-start => 2, -end =>
> 4, -primary => "sub1"), EXPAND);
> $feat->add_sub_SeqFeature(Bio::SeqFeature::Generic->new(-start => 6, -end =>
> 8, -primary => "sub2"), EXPAND);
> # could add more
> 
> # attach to sequence
> $seq->add_SeqFeature($feat);
> 
> # print in GenBank format (note that there is lots of stuff missing, like
> species etc)
> my $seqout = Bio::SeqIO->new(-fh => \*STDOUT, -format => "genbank");
> 
> $seqout->write_seq($seq);
> 
> $seqout->close();
> 
> And here's the results:
> 
> LOCUS       test01            20 bp     DNA  UNK
> DEFINITION
> ACCESSION   unknown
> FEATURES             Location/Qualifiers
>      sub1            2..4
>      sub2            6..8
>      test            Bio::SeqFeature::Generic=HASH(0xd58d0)..4

This looks like a Location bug. Maybe because of the 'EXPAND'. Hmm.
Jason, any idea? Anyway, I've submitted it as a bug report.

	Hilmar
-- 
-------------------------------------------------------------
Hilmar Lapp                            email: lapp@gnf.org
GNF, San Diego, Ca. 92121              phone: +1-858-812-1757
-------------------------------------------------------------