Bioperl: Bio::Root::RootI::_rearrange

[Ewan Birney]

On Tue, 6 Jun 2000, Chris Mungall wrote:

> 
> 
> On Tue, 6 Jun 2000, James Gilbert wrote:
> 
> > 
> > 
> > The Bio::Root::RootI::_rearrange method, which is
> > used to parse arguments like:
> > 
> > 	$obj = Class->new(
> > 	    -id => 'foo',
> > 	    -seq => 'acatgctagagctagcatcgacgatg',
> > 	    );
> > 
> > doesn't do anything if you pass invalid options
> > (if, for example, "seq" isn't a valid option for
> > the "new" method above).  I think it should throw
> > an exception.  Does anyone object if I add this?
> > I can't see that it will break anything, unless
> > someone relies on this behaviour.
> 
> Hi James
> 
> what if Class inherits from/delegates to another class, passing the same
> initializtion args? the superclass / handler class may not know what to do
> with all the args.

Chris and Hilmar are right and I must have been dozing. 

This will cause problems to inheritance. 

>  
> > 	James
> > 
> > James G.R. Gilbert
> > The Sanger Centre
> > Wellcome Trust Genome Campus
> > Hinxton
> > Cambridge                        Tel: 01223 494906
> > CB10 1SA                         Fax: 01223 494919
> 
> ------------------------------------------------------------------
> Chris Mungall            	Berkeley Drosophila Genome Project
> cjm@fruitfly.berkeley.edu	http://www.fruitfly.org
> 
> =========== Bioperl Project Mailing List Message Footer =======
> Project URL: http://bio.perl.org/
> For info about how to (un)subscribe, where messages are archived, etc:
> http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
> ====================================================================
> 

-----------------------------------------------------------------
Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
<birney@ebi.ac.uk>. 
-----------------------------------------------------------------

=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org/
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
====================================================================