Bioperl: Bio::Root::RootI::_rearrange

[Chris Mungall]

On Tue, 6 Jun 2000, James Gilbert wrote:

> 
> 
> The Bio::Root::RootI::_rearrange method, which is
> used to parse arguments like:
> 
> 	$obj = Class->new(
> 	    -id => 'foo',
> 	    -seq => 'acatgctagagctagcatcgacgatg',
> 	    );
> 
> doesn't do anything if you pass invalid options
> (if, for example, "seq" isn't a valid option for
> the "new" method above).  I think it should throw
> an exception.  Does anyone object if I add this?
> I can't see that it will break anything, unless
> someone relies on this behaviour.

Hi James

what if Class inherits from/delegates to another class, passing the same
initializtion args? the superclass / handler class may not know what to do
with all the args.
 
> 	James
> 
> James G.R. Gilbert
> The Sanger Centre
> Wellcome Trust Genome Campus
> Hinxton
> Cambridge                        Tel: 01223 494906
> CB10 1SA                         Fax: 01223 494919

------------------------------------------------------------------
Chris Mungall            	Berkeley Drosophila Genome Project
cjm@fruitfly.berkeley.edu	http://www.fruitfly.org

=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org/
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
====================================================================