Bioperl: Bio::Root::RootI::_rearrange

[James Gilbert]

As Chris and Hilmar have both pointed out, we
can't do this, because a standard BioPerl
_initialize looks like:

sub _initialize {
  my($self,@args) = @_;

  my $make = $self->SUPER::_initialize(@args);

and _rearrange may be called in SUPER::_initialize
and know about arguments which this class doesn't.

	Oh well,  James

James G.R. Gilbert
The Sanger Centre
Wellcome Trust Genome Campus
Hinxton
Cambridge                        Tel: 01223 494906
CB10 1SA                         Fax: 01223 494919


> The Bio::Root::RootI::_rearrange method, which is
> used to parse arguments like:
> 
>      $obj = Class->new(
>          -id => 'foo',
>          -seq => 'acatgctagagctagcatcgacgatg',
>          );
> 
> doesn't do anything if you pass invalid options
> (if, for example, "seq" isn't a valid option for
> the "new" method above).  I think it should throw
> an exception.  Does anyone object if I add this?
> I can't see that it will break anything, unless
> someone relies on this behaviour.
> 
>      James

=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org/
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
====================================================================