Bioperl: Bio::Root::RootI::_rearrange
   
    Ewan Birney
     
    birney@ebi.ac.uk
       
    Tue, 6 Jun 2000 16:36:35 +0100 (GMT)
    
    
  
On Tue, 6 Jun 2000, James Gilbert wrote:
> 
> 
> The Bio::Root::RootI::_rearrange method, which is
> used to parse arguments like:
> 
> 	$obj = Class->new(
> 	    -id => 'foo',
> 	    -seq => 'acatgctagagctagcatcgacgatg',
> 	    );
> 
> doesn't do anything if you pass invalid options
> (if, for example, "seq" isn't a valid option for
> the "new" method above).  I think it should throw
> an exception.  Does anyone object if I add this?
> I can't see that it will break anything, unless
> someone relies on this behaviour.
Ok to add it on the main trunk, but not the branch.
> 
> 	James
> 
> James G.R. Gilbert
> The Sanger Centre
> Wellcome Trust Genome Campus
> Hinxton
> Cambridge                        Tel: 01223 494906
> CB10 1SA                         Fax: 01223 494919
> 
> =========== Bioperl Project Mailing List Message Footer =======
> Project URL: http://bio.perl.org/
> For info about how to (un)subscribe, where messages are archived, etc:
> http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
> ====================================================================
> 
-----------------------------------------------------------------
Ewan Birney. Mobile: +44 (0)7970 151230, Work: +44 1223 494420
<birney@ebi.ac.uk>. 
-----------------------------------------------------------------
=========== Bioperl Project Mailing List Message Footer =======
Project URL: http://bio.perl.org/
For info about how to (un)subscribe, where messages are archived, etc:
http://www.techfak.uni-bielefeld.de/bcd/Perl/Bio/vsns-bcd-perl.html
====================================================================