[EMBOSS] fuzznuc and sequence ID

[David Bauer]

Dear Philippe,

the problem with this fasta header line is the ":".
EMBOSS interprets anything before the ":" as name of a database where this sequence comes from and does not treat this as part of the sequence name. 
http://emboss.sourceforge.net/docs/themes/UniformSequenceAddress.html

If you replace the ":" in your input file by e.g. "_" you will get the full sequence name in the output of fuzznuc  (or any other EMBOSS program).

HTH,
David.

-----Ursprüngliche Nachricht-----
Von: emboss-bounces at lists.open-bio.org [mailto:emboss-bounces at lists.open-bio.org] Im Auftrag von Philippe DESSEN
Gesendet: 10 June 2013 12:29
An: emboss at emboss.open-bio.org
Betreff: [EMBOSS] fuzznuc and sequence ID



Dear all,

I use fuzznuc to find some patterns in an extract of the human genome  as a fasta file with several parts :

>chr1:562520-566670
GGAGTGGTAGCTCTCAGTATAGTCAGCCTCTAAGAAGAGAGCAAATGTTT
ATTTTCAAGAAGAATTATGCAGAAAGGGCCACTTTCAGTCTACCATCCCC
CCAGATTCCTTGAAGGCAGGATGATGTGAGCAGCAAGGGAAGAAAGGGGA
GTGGGCACGAAATACTACAGAACCTGCAGGGAACGAAGTCCCTCTGTCTG
;..
>

Curiously the report of fuzznuc  (default)  is like that   without the same identifier as on the fasta file 

########################################
# Program: fuzznuc
# Rundate: Mon Jun 10 2013 11:56:52
# Commandline: fuzznuc
#    [-sequence] xxxx.fdr01peaks.hg19.fasta
#    -pattern xxxxxxx
#    -complement
#    -outfile fuzz.txt
# Report_format: seqtable
# Report_file: _fuzz.txt
########################################

#=======================================
#
# Sequence:  Sequence: 562520-566670     from: 1   to: 4151
# HitCount: 0
#
#

It is not possible to localize the segment on the full genome without the chromosome !!


--
Best 
Philippe Dessen
IGR, Villejuif, France


_______________________________________________
EMBOSS mailing list
EMBOSS at lists.open-bio.org
http://lists.open-bio.org/mailman/listinfo/emboss