[EMBOSS] fuzznuc and sequence ID
Philippe DESSEN
dessen at igr.fr
Mon Jun 10 10:28:34 UTC 2013
Dear all,
I use fuzznuc to find some patterns in an extract of the human genome as a fasta file with several parts :
>chr1:562520-566670
GGAGTGGTAGCTCTCAGTATAGTCAGCCTCTAAGAAGAGAGCAAATGTTT
ATTTTCAAGAAGAATTATGCAGAAAGGGCCACTTTCAGTCTACCATCCCC
CCAGATTCCTTGAAGGCAGGATGATGTGAGCAGCAAGGGAAGAAAGGGGA
GTGGGCACGAAATACTACAGAACCTGCAGGGAACGAAGTCCCTCTGTCTG
;..
>
Curiously the report of fuzznuc (default) is like that without the same identifier as on the fasta file
########################################
# Program: fuzznuc
# Rundate: Mon Jun 10 2013 11:56:52
# Commandline: fuzznuc
# [-sequence] xxxx.fdr01peaks.hg19.fasta
# -pattern xxxxxxx
# -complement
# -outfile fuzz.txt
# Report_format: seqtable
# Report_file: _fuzz.txt
########################################
#=======================================
#
# Sequence: Sequence: 562520-566670 from: 1 to: 4151
# HitCount: 0
#
#
It is not possible to localize the segment on the full genome without the chromosome !!
--
Best
Philippe Dessen
IGR, Villejuif, France
More information about the EMBOSS
mailing list