[EMBOSS] Support for multi-line annotation in ig format

[Peter Rice]

On 15/08/2012 17:57, Daniel Rozenbaum wrote:
> Dear list,
>
> (Peter, many thanks for your prompt reply to my previous inquiry!)
>
> We need to deal with extensive databases in Intelligenetics format with multiple lines in annotation of each record. It appears however that EMBOSS concatenates all annotation lines into a single line when building its internal representation of the sequence description:
>
> % cat /tmp/IGSEQ.ig
> ; Annotation line 1
> ; Annotation line 2
> ; Annotation line 3
> IGSEQ
> ACGCATCGCATCAGACTACGC1
>
>
> % seqret /tmp/IGSEQ.ig -osformat2 ig -auto -osname IGSEQ.emboss_ig2ig -osdirectory /tmp
>
>
> % cat /tmp/IGSEQ.emboss_ig2ig.ig
> ;Annotation line 1 Annotation line 2 Annotation line 3, 21 bases
> IGSEQ
> ACGCATCGCATCAGACTACGC1
>
> Are there any plans to support multi-line annotation in this format?

Interesting thought. We will take a look. It will need some care to 
maintain compatibility with other formats that have single (FASTA) or 
multiple (swissprot) descriptions.

Which package is using this IG format?

regards,

Peter Rice
EMBOSS Team