[EMBOSS] Support for multi-line annotation in ig format
Peter Rice
ricepeterm at yahoo.co.uk
Wed Aug 15 17:36:25 UTC 2012
On 15/08/2012 17:57, Daniel Rozenbaum wrote:
> Dear list,
>
> (Peter, many thanks for your prompt reply to my previous inquiry!)
>
> We need to deal with extensive databases in Intelligenetics format with multiple lines in annotation of each record. It appears however that EMBOSS concatenates all annotation lines into a single line when building its internal representation of the sequence description:
>
> % cat /tmp/IGSEQ.ig
> ; Annotation line 1
> ; Annotation line 2
> ; Annotation line 3
> IGSEQ
> ACGCATCGCATCAGACTACGC1
>
>
> % seqret /tmp/IGSEQ.ig -osformat2 ig -auto -osname IGSEQ.emboss_ig2ig -osdirectory /tmp
>
>
> % cat /tmp/IGSEQ.emboss_ig2ig.ig
> ;Annotation line 1 Annotation line 2 Annotation line 3, 21 bases
> IGSEQ
> ACGCATCGCATCAGACTACGC1
>
> Are there any plans to support multi-line annotation in this format?
Interesting thought. We will take a look. It will need some care to
maintain compatibility with other formats that have single (FASTA) or
multiple (swissprot) descriptions.
Which package is using this IG format?
regards,
Peter Rice
EMBOSS Team
More information about the EMBOSS
mailing list