[EMBOSS] Support for multi-line annotation in ig format

[Daniel Rozenbaum]

Dear list,

(Peter, many thanks for your prompt reply to my previous inquiry!)

We need to deal with extensive databases in Intelligenetics format with multiple lines in annotation of each record. It appears however that EMBOSS concatenates all annotation lines into a single line when building its internal representation of the sequence description:

% cat /tmp/IGSEQ.ig
; Annotation line 1
; Annotation line 2
; Annotation line 3
IGSEQ
ACGCATCGCATCAGACTACGC1


% seqret /tmp/IGSEQ.ig -osformat2 ig -auto -osname IGSEQ.emboss_ig2ig -osdirectory /tmp


% cat /tmp/IGSEQ.emboss_ig2ig.ig
;Annotation line 1 Annotation line 2 Annotation line 3, 21 bases
IGSEQ
ACGCATCGCATCAGACTACGC1

Are there any plans to support multi-line annotation in this format?

Many thanks,
Daniel