[EMBOSS] Antwort: extract translations from genbank file

[david.bauer at bayerhealthcare.com]

Hi Karin,

you can pipe the output from extractfeat into transeq to get the protein 
sequence:

extractfeat  mysequence.gb -type CDS -stdout | transeq -filter

HTH,

David.

emboss-bounces at lists.open-bio.org schrieb am 24/08/2010 19:43:49:

> Extractfeat gives me sensible description lines, but for now I have not 
> been able to make it give me the protein, and not the DNA sequence.
> 
> >scaffold00002_93_1919 [CDS] Contig scaffold00002
> atgaccctagaaaatacctctcccaatcctagtcaaatttccctaaatttgtcgggagga
> attgccctcggagcttatatggctggggtgtgttttgaattagttagacaagccagaaaa
> gacaattctcccctgttaattgatttgattaccggagcatctgctggggcgatgaccgga
> ....
> 
> 
> So. Are there any other programs, or options/switches to the ones that I 

> have mentioned that I should be using?
> 
> 
> TIA,
> 
> Karin
> 
> -- 
> Karin Lagesen
> Post Doc
> Centre of Ecological and Evolutionary Synthesis (CEES)
> Department of Biology
> University of Oslo
> P.O. Box 1066 - Blindern
> N-0316 Oslo
> Norway
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss