[EMBOSS] EMBOSS eprimer3 and latest primer3_core

[ajb at ebi.ac.uk]

Hi,

A conversion was done on eprimer3.c earlier today to
use the new tag names. That was the easy bit. The hard bit
is deciding on names for the new and old version (we
intend having two versions for now and retiring the current, stable,
version at some stage).

Alan


> Hi,
> I've just installed the beta version of primer3-2.2.2 also. The boulder_io
> format has been changed. For example, instead of
> SEQUENCE=ACGT....
> the new tag is
> SEQUENCE_TEMPLATE=ACGT...
> also, notice the underscores (they are hard to see in the html manual,
> cause of the link markup)
>
> I tested primer3_core. It works with this example:
> SEQUENCE_ID=PT203_A02
> SEQUENCE_TEMPLATE=GTGCCGTGCTCGGCTTCTCTGGTCACAGTCTTTTGTCTCTAGGGCTAAGACAGTGCCTGTCCCTGAAAAGTGGACCACTCCTCAAGAGATAAAACAAAAGATCCAACTCCTCCACCAGAAGTCAGAGTTTGTGGAGAAGAGCACAAAGTACTTCTCAGGTAGATGGGCTTGGGAGAAGATTGGAGGTGCATGCTCACTTCCTCCCTAAGATCCACATAGCCCAGAGCCCCTCACTTCCCTCCTCTTCCCCTGGTCTTGCTGACCTGCCTTCAACCTCTCCTCCATCTGTCCCTGGCTGAGGGACCTAACTCCAGCTTCTCTCTGCTCCCTTTCCCACATTTTAGAAACCCTGCGTTCAGAAATGGAAATGTTCAATGGTGAGTCCAGCGGTAATGGTGTGTGCTGGCCTGGGGTTGTTGCAGTGTTCCCTTGTGCTGTTGACTTGAGGGGCCCTATTTAGAAGACAAAAAAAAAACCAAACACCTGGGGGCAAAAGTAAAA
> SEQUENCE_TARGET=395,12
> PRIMER_TASK=pick_detection_primers
> PRIMER_PICK_LEFT=1
> PRIMER_PICK_INTERNAL=1
> PRIMER_PICK_RIGHT=1
> PRIMER_OPT_SIZE=20
> PRIMER_MIN_SIZE=17
> PRIMER_MAX_SIZE=23
> PRIMER_MAX_NS_ACCEPTED=1
> PRIMER_PRODUCT_SIZE_RANGE=75-300
> P3_FILE_FLAG=1
> PRIMER_EXPLAIN_FLAG=1
> =
>
> But eprimer3 dies:
> Error: Unable to read sequence './boulderio_template.txt'
> Died: eprimer3 terminated: Bad value for '-sequence' and no prompt
>
> Is it that the new format has not yet been accommodated?
>
>
> thanks,
> Tom
>
> Thomas (Tom) Keller, PhD
> kellert at ohsu.edu
> 503.494.2442
> 6339b R Jones Hall (BSc/CROET)
> www.ohsu.edu/xd/research/research-cores/dna-analysis/
>
> On Apr 13, 2010, at 4:43 AM, Peter wrote:
>
>> Hello EMBOSS team,
>>
>> I'm using EMBOSS 6.2.0 on Mac OS X 10.6.3 Snow Leopard:
>>
>> $ embossversion
>> Reports the current EMBOSS version number
>> 6.2.0
>>
>> I need to design some primers so I wanted to try the EMBOSS tool
>> eprimer3, which as your documentation clearly explains requires me to
>> install the 'primer3' program from the Whitehead Institute
>> (specifically the primer3_core tool).
>>
>> I downloaded and compiled the latest version of primer3, version 2.2.2
>> beta (using the default, i.e. just "make", which seems to be fine -
>> the Snow Leopard specific Makefile failed). It seems that EMBOSS
>> eprimer3 does not like this:
>>
>> $ export
>> EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-2.2.2-beta/src/primer3_core"
>> $ eprimer3 fasta::lupine.nu lupine.eprimer3
>> Picks PCR primers and hybridization oligos
>> Error: Missing SEQUENCE tag
>>
>> Instead, I downloaded and compiled primer3 version 1.1.4 (using the
>> defaults, i.e. just "make", there is no Snow Leopard specific Makefile
>> included) and that seems to work:
>>
>> $ export
>> EMBOSS_PRIMER3_CORE="/Users/xxx/Downloads/Software/primer3-1.1.4/src/primer3_core"
>> $ eprimer3 fasta::lupine.nu lupine.eprimer3Picks PCR primers and
>> hybridization oligos
>> Picks PCR primers and hybridization oligos
>>
>> The eprimer3 output looks sensible too.
>>
>> My guess is that something in the recent primer3 alpha and beta
>> releases of 2.x.x has changed since version 1.x.x and that EMBOSS
>> needs to be updated to cope. Is this a known issue?
>>
>> Thanks,
>>
>> Peter C.
>> _______________________________________________
>> EMBOSS mailing list
>> EMBOSS at lists.open-bio.org
>> http://lists.open-bio.org/mailman/listinfo/emboss
>
>
> _______________________________________________
> EMBOSS mailing list
> EMBOSS at lists.open-bio.org
> http://lists.open-bio.org/mailman/listinfo/emboss
>