[EMBOSS] Does not manage to use .embossrc from the current directory.

[Peter Rice]

Charles Plessy wrote:
> Dear EMBOSS programmers,
> 
> I am using EMBOSS in a context where I can not expect $HOME to be set. 
> Therefore, I created a .embossrc from a template and attempted to use it in
> the current directory. However, EMBOSS does not seem to read it, despite what
> is written in the documentation:
> 
> # It does not work, but the .embossrc is functional in $HOME
> 
> sorbet【tmp】$ seqret mirbase:MI0000007 stdout Reads and writes (returns)
> sequences Error: Failed to open filename 'mirbase' Error: Unable to read
> sequence 'mirbase:MI0000007' Died: seqret terminated: Bad value for
> '-sequence' and no prompt
> 
> sorbet【tmp】$ cp .embossrc $HOME
> 
> sorbet【tmp】$ seqret mirbase:MI0000007 stdout Reads and writes (returns)
> sequences
>> cel-mir-36 MI0000007 Caenorhabditis elegans miR-36 stem-loop
> caccgcugucggggaaccgcgccaauuuucgcuucagugcuagaccauccaaagugucua 
> ucaccgggugaaaauucgcauggguccccgacgcgga
> 
> # Strace confirms that the current dir is not searched for .embossrc
> 
> sorbet【tmp】$ rm $HOME/.embossrc
> 
> sorbet【tmp】$ strace seqret mirbase:MI0000007 stdout 2>&1 | grep embossrc 
> open("/home/charles/.embossrc", O_RDONLY|O_LARGEFILE) = -1 ENOENT (No such
> file or directory)

Ah, that is a documentation error. EMBOSS no longer looks in the current
directory. We are writing a new admin guide.
But another suggestion in the same part of the admin guide is what you need.

EMBOSS has a way to redirect $HOME (we use it to redirect $HOME/.embossrc when
running QA tests. Define EMBOSSRC to be the current directory (you can use ".")

Interesting ... I had not tried strace. Looks useful.

Running seqret with -debug will also report where it is trying to open files.

A good way to check whether your emboss.defaults and .embossrc files were used
is to run showdb -full to list all the databases you have defined.

Databases in $HOME/embossrc appear as "user". Databases in $EMBOSSRC/.embossrc
appear as "special"

> Interestingly, it searches also emboss.default in a place which is not 
> expected: where I compiled EMBOSS... Can I have made a mistake at compilation
>  time which would prevent `pwd`/.embossrc to be parsed?


This is intentional. EMBOSS looks for data files in the install directories and
also in the source directory - in case users are testing EMBOSS and have not run
"make install". The source directory is only searched if the installed file is 
not found.

regards,

Peter