[EMBOSS] Question about DeltaS and DeltaH

[Bassi, Sebastian]

Hello,

I'm trying to reproduce the DeltaS and deltaH results from dan.c in Python (in order to add tm as a function in BioPython). But I found some differences in dan's DeltaS calculation and my own calculations.
I tried to follow EMBOSS code (dan.c, ajdan.c, Edna.melt) but I am not an C expert (just a newbie) so I can't follow all the code.
I will tell you what I'm doing, maybe somebody could point me out my mistake.
To get DeltaS (entropy) I'm adding all the ocurrences of all neighbor pair secuences:

Take this sequence: ACCCTTCAGCAGTTCCACAC

Here are all neighbors and their DeltaS values:

AC = 22.4
CC = 19.9
CT = 21
TT = 22.2
TC = 22.2
CA = 22.7
AG = 21
GC = 24.4
CA = 22.7
AG = 21
GT = 22.4
TT = 22.2
TC = 22.2
CC = 19.9
CA = 22.7
AC = 22.4
CA = 22.7
AC = 22.4
Grant total = 396.4

According to DAN, the result should be:
416.3

It seems there is something I'm missing.  Could you please give me a hint about this?

Sebastian Bassi.
Advanta Seeds. Balcarce Research Station.