needle -filter

[simon andrews (BI)]

> -----Original Message-----
> From: Jonathan Barber [mailto:jon at compbio.dundee.ac.uk]
> Sent: 10 June 2003 10:31
> To: 'emboss at embnet.org'
> Subject: Re: needle -filter
> 
> > As an aside, the idea of the asis: USA is a really nice way around
> > this whole problem.  The trouble is that it's limited (I presume) by
> > the command line length your shell allows, and by you not being able
> > to specify a name for the sequence.  If there was some easy 
> > way around  this limitation, then that would solve the problem for the 
> > situations I can think I'm likely to encounter.
> 
> Again, if you're using Perl, then you can use system() with a list
> argument rather than a scalar, and this will avoid the shell, if your
> command doesn't have any shell metacharacters in it (perldoc 
> -f system).

System doesn't help me as I can't read STDOUT from it, but looking at
the docs for IPC::Open3 it looks like I can do the whole thing that
way instead.  Cheers for the pointer, I wouldn't have throught about
doing it that way!

After a bit of playing, it's not quite as easy as I'd hoped, but I got
it to work.  The script at the bottom shows one way to get needle to 
work without having to write anything to disk.

One quick extra feature request though.  For the asis:: USA, would it be
possible to assign a name to the sequences passed in, even if it's 
only 1,2,3 or seq1 seq2 seq3 etc.  It would make parsing of output files
much easier.  A way to specify a name in the USA would be even better
(eg asis::name>GAGAGTGTAGT or whatever).

Cheers for all the help on this, it seems to have provoked some interesting
discussion.

	TTFN

	Simon.


#!/usr/bin/perl -w
use strict;
use IPC::Open3;

my $seq_a = 'CCAGCCCATTTATCTATACCATGAGGTAACTGAAGTAAGGAGAGCAGTGA';

my $seq_b = 'CCAGCCCATTTATCTATACCATGAGGTTTCTGAAGTAAGGAGAGCAGTGA';

open (ERRORS,'>/dev/null') || die "Can't open /dev/null :$!";

open3 (\*INPUT,\*OUTPUT,\*ERRORS,'needle',"asis::$seq_a","asis::$seq_b");

print INPUT "10\n";
print INPUT "0.5\n";
print INPUT "stdout\n";
print INPUT "\n";

close INPUT;

print "OUTPUT: $_" while (<OUTPUT>);