[Biopython] RNA secondary structure with RNAfold

[XiaoJu Zhang]

Hi Jakub,

This might be a bit tangent to your question. If you want to just predict
secondary structure from RNA sequence, you can try RNAStructure program,
which is developed by David Mathew's lab. Here are the links for the web
server and stand alone program download:
http://rna.urmc.rochester.edu/RNAstructureWeb/
http://rna.urmc.rochester.edu/RNAstructure.html

Good luck.

Ju


On Fri, Nov 28, 2014 at 7:41 PM, Jakub Stanislaw Nowak <jakub.nowak at ed.ac.uk
> wrote:

> Hello everyone,
>
> I am trying to model secondary structures of some RNA.
>
> As I am not an expert in programming it is quite a challenge for me so far
> I found a way to access RNAfold from biopython via biomanycores.
>
> I downloaded and installed both biomanycores and RNAfold tools in
> /usr/local/bin/
>
> and wrote a simple test script in python before loading my dataset
>
> from Biomanycores import RNAFold
>
> RNA = 'CUGCAUUGGCCAAAUUGGCCCUACUACGUAUGCUAGCAUGAGAUGUGACAGUACAGUGUACUUAC'
>
> structure = RNAFold.execute(RNA)
>
> print(structure)
>
>
>
> Unfortunately it hasn’t work and generated this error message:
>
> Traceback (most recent call last):
>
>   File "/Users/user/Google Drive/Bioinformatics/smallRNAseq/Python
> secondary structure/RNAFoldtest", line 9, in <module>
>
>     structure = RNAFold.execute(RNA)
>
>   File
> "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Biomanycores-1.1210-py2.7.egg/Biomanycores/RNAFold.py",
> line 221, in execute
>
>     handle, delta = rnafold_cmd.run(verbose=verbose)
>
>   File
> "/Library/Frameworks/Python.framework/Versions/2.7/lib/python2.7/site-packages/Biomanycores-1.1210-py2.7.egg/Biomanycores/AbstractCommandline.py",
> line 141, in run
>
>     stderr=stderr_str)
>
> ApplicationError: Non-zero return code 1 from '/usr/local/bin/RNAfold -f',
> message '/usr/local/bin/RNAfold: invalid option -- f'
>
>
> >>>
>
>
> Do you know any solution for my problem? Alternatively maybe you know of
> some different approach to analyse secondary structure with biopython?
>
> All best,
>
> Jakub
>
> The University of Edinburgh is a charitable body, registered in
> Scotland, with registration number SC005336.
>
> _______________________________________________
> Biopython mailing list  -  Biopython at mailman.open-bio.org
> http://mailman.open-bio.org/mailman/listinfo/biopython
>
-------------- next part --------------
An HTML attachment was scrubbed...
URL: <http://mailman.open-bio.org/pipermail/biopython/attachments/20141201/90f9268b/attachment.html>